Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.
| Version Number | Version Date | Version Type/Reason | Version Change | Revised CIF Category | |
|---|---|---|---|---|---|
| 1.0 | 2016-07-27 | Initial release | |||
| 1.1 | 2023-09-27 | Data collection, Database references, Derived calculations, Refinement description | chem_comp_atom, chem_comp_bond, database_2, diffrn_radiation_wavelength, pdbx_initial_refinement_model, pdbx_prerelease_seq, pdbx_struct_oper_list | Download |














