5DS9
Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)
X-RAY DIFFRACTION
Starting Model(s)
Initial Refinement Model(s) | |||
---|---|---|---|
Type | Source | Accession Code | Details |
experimental model | PDB | 3IV5 |
Crystallization
Crystalization Experiments | ||||
---|---|---|---|---|
ID | Method | pH | Temperature | Details |
1 | VAPOR DIFFUSION, HANGING DROP | 8.5 | 277 | 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400 |
Crystal Properties | |
---|---|
Matthews coefficient | Solvent content |
4.02 | 69.39 |
Crystal Data
Unit Cell | |
---|---|
Length ( Å ) | Angle ( ˚ ) |
a = 43.29 | α = 90 |
b = 93.95 | β = 90 |
c = 154.51 | γ = 90 |
Symmetry | |
---|---|
Space Group | P 21 21 21 |
Diffraction
Diffraction Experiment | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Crystal ID | Scattering Type | Data Collection Temperature | Detector | Detector Type | Details | Collection Date | Monochromator | Protocol | |||||
1 | 1 | x-ray | 100 | CCD | ADSC QUANTUM 315 | 2010-10-17 | M | SINGLE WAVELENGTH |
Radiation Source | |||||
---|---|---|---|---|---|
ID # | Source | Type | Wavelength List | Synchrotron Site | Beamline |
1 | SYNCHROTRON | APS BEAMLINE 24-ID-C | 0.97949 | APS | 24-ID-C |
Data Collection
Overall | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Resolution (High) | Resolution (Low) | Percent Possible (Observed) | R Merge I (Observed) | Rpim I (All) | CC (Half) | Net I Over Average Sigma (I) | Redundancy | Number Reflections (All) | Number Reflections (Observed) | Observed Criterion Sigma (F) | Observed Criterion Sigma (I) | B (Isotropic) From Wilson Plot | ||||||
1 | 2.56 | 154.51 | 91.6 | 0.067 | 0.03 | 0.998 | 14.7 | 5.8 | 19332 | 38.59 |
Highest Resolution Shell | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Resolution (High) | Resolution (Low) | Percent Possible (All) | Percent Possible (Observed) | R Merge I (Observed) | Rpim I (All) | CC (Half) | Mean I Over Sigma (Observed) | Redundancy | Number Unique Reflections (All) | |||||||||
1 | 2.56 | 2.7 | 63.5 | 0.69 | 0.397 | 0.785 | 2.2 | 3.7 | 1903 |
Refinement
Statistics | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction ID | Structure Solution Method | Cross Validation method | Starting model | Resolution (High) | Resolution (Low) | Cut-off Sigma (F) | Number Reflections (Observed) | Number Reflections (R-Free) | Percent Reflections (Observed) | R-Factor (Observed) | R-Work | R-Free | Mean Isotropic B | ||||||
X-RAY DIFFRACTION | MOLECULAR REPLACEMENT | FREE R-VALUE | 3IV5 | 2.561 | 45.162 | 1.34 | 19020 | 937 | 90.27 | 0.2243 | 0.2229 | 0.2514 | 57.283 |
Temperature Factor Modeling | ||||||
---|---|---|---|---|---|---|
Anisotropic B[1][1] | Anisotropic B[1][2] | Anisotropic B[1][3] | Anisotropic B[2][2] | Anisotropic B[2][3] | Anisotropic B[3][3] | |
RMS Deviations | |
---|---|
Key | Refinement Restraint Deviation |
f_dihedral_angle_d | 26.576 |
f_angle_d | 1.043 |
f_chiral_restr | 0.042 |
f_bond_d | 0.017 |
f_plane_restr | 0.005 |
Non-Hydrogen Atoms Used in Refinement | |
---|---|
Non-Hydrogen Atoms | Number |
Protein Atoms | 1505 |
Nucleic Acid Atoms | 1101 |
Solvent Atoms | 4 |
Heterogen Atoms |
Software
Software | |
---|---|
Software Name | Purpose |
PHENIX | refinement |
Aimless | data scaling |
PHASER | phasing |
PDB_EXTRACT | data extraction |
XDS | data reduction |