1QWA | pdb_00001qwa

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.


Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.


Version NumberVersion DateVersion Type/Reason Version ChangeRevised CIF Category
1.02003-11-25Initial release
1.12008-04-29Version format compliance
1.22011-07-13Version format compliance
1.32012-02-01Other Download
2.02021-04-07Data collection, Database references, Non-polymer description, Source and taxonomy, Structure summarychem_comp, pdbx_entity_src_syn, pdbx_nmr_software, struct_ref, struct_ref_seq, struct_ref_seq_dif
2.12024-05-01Data collection, Database referenceschem_comp_atom, chem_comp_bond, database_2 Download