NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.
| Version Number | Version Date | Version Type/Reason | Version Change | Revised CIF Category | |
|---|---|---|---|---|---|
| 1.0 | 2003-11-25 | Initial release | |||
| 1.1 | 2008-04-29 | Version format compliance | |||
| 1.2 | 2011-07-13 | Version format compliance | |||
| 1.3 | 2012-02-01 | Other | Download | ||
| 2.0 | 2021-04-07 | Data collection, Database references, Non-polymer description, Source and taxonomy, Structure summary | chem_comp, pdbx_entity_src_syn, pdbx_nmr_software, struct_ref, struct_ref_seq, struct_ref_seq_dif | ||
| 2.1 | 2024-05-01 | Data collection, Database references | chem_comp_atom, chem_comp_bond, database_2 | Download |














