1QWA

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 17 
  • Conformers Submitted: 17 
  • Selection Criteria: all calculated structures submitted,back calculated data agree with experimental NOESY spectrum,structures with acceptable covalent geometry,structures with the least restraint violations,structures with the lowest energy 

wwPDB Validation 3D Report Full Report


This is version 1.3 of the entry. See complete history

Literature

Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin

Finger, L.D.Trantirek, L.Johansson, C.Feigon, J.

(2003) Nucleic Acids Res. 31: 6461-6472

  • Primary Citation of Related Structures:  

  • PubMed Abstract: 
  • Nucleolin, a multi-domain protein involved in ribosome biogenesis, has been shown to bind the consensus sequence (U/G)CCCG(A/G) in the context of a hairpin loop structure (nucleolin recognition element; NRE). Previous studies have shown that the firs ...

    Nucleolin, a multi-domain protein involved in ribosome biogenesis, has been shown to bind the consensus sequence (U/G)CCCG(A/G) in the context of a hairpin loop structure (nucleolin recognition element; NRE). Previous studies have shown that the first two RNA-binding domains in nucleolin (RBD12) are responsible for the interaction with the in vitro selected NRE (sNRE). We have previously reported the structures of nucleolin RBD12, sNRE and nucleolin RBD12-sNRE complex. A comparison of free and bound sNRE shows that the NRE loop becomes structured upon binding. From this observation, we hypothesized that the disordered hairpin loop of sNRE facilitates conformational rearrangements when the protein binds. Here, we show that nucleolin RBD12 is also sufficient for sequence- specific binding of two NRE sequences found in pre-rRNA, b1NRE and b2NRE. Structural investigations of the free NREs using NMR spectroscopy show that the b1NRE loop is conformationally heterogeneous, while the b2NRE loop is structured. The b2NRE forms a hairpin capped by a YNMG-like tetraloop. Comparison of the chemical shifts of sNRE and b2NRE in complex with nucleolin RBD12 suggests that the NRE consensus nucleotides adopt a similar conformation. These results show that a disordered NRE consensus sequence is not a prerequisite for nucleolin RBD12 binding.


    Organizational Affiliation

    Department of Chemistry and Biochemistry, and Molecular Biology Institute, University of California, Los Angeles, CA 90095-1569, USA.




Macromolecules

Find similar proteins by: Sequence  |  Structure

Entity ID: 1
MoleculeChainsLengthOrganism
18S ribosomal RNA, 5'ETSA21N/A
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 17 
  • Conformers Submitted: 17 
  • Selection Criteria: all calculated structures submitted,back calculated data agree with experimental NOESY spectrum,structures with acceptable covalent geometry,structures with the least restraint violations,structures with the lowest energy 

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History 

Deposition Data

Revision History 

  • Version 1.0: 2003-11-25
    Type: Initial release
  • Version 1.1: 2008-04-29
    Type: Version format compliance
  • Version 1.2: 2011-07-13
    Type: Version format compliance
  • Version 1.3: 2012-02-01
    Type: Other