5BTG

Crystal structure of a topoisomerase II complex


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.5 Å
  • R-Value Free: 0.249 
  • R-Value Work: 0.226 

wwPDB Validation 3D Report Full Report


This is version 1.1 of the entry. See complete history

Literature

Crystal structure and stability of gyrase-fluoroquinolone cleaved complexes from Mycobacterium tuberculosis.

Blower, T.R.Williamson, B.H.Kerns, R.J.Berger, J.M.

(2016) Proc.Natl.Acad.Sci.USA 113: 1706-1713

  • DOI: 10.1073/pnas.1525047113
  • Primary Citation of Related Structures:  

  • PubMed Abstract: 
  • Mycobacterium tuberculosis (Mtb) infects one-third of the world's population and in 2013 accounted for 1.5 million deaths. Fluoroquinolone antibacterials, which target DNA gyrase, are critical agents used to halt the progression from multidrug-resist ...

    Mycobacterium tuberculosis (Mtb) infects one-third of the world's population and in 2013 accounted for 1.5 million deaths. Fluoroquinolone antibacterials, which target DNA gyrase, are critical agents used to halt the progression from multidrug-resistant tuberculosis to extensively resistant disease; however, fluoroquinolone resistance is emerging and new ways to bypass resistance are required. To better explain known differences in fluoroquinolone action, the crystal structures of the WT Mtb DNA gyrase cleavage core and a fluoroquinolone-sensitized mutant were determined in complex with DNA and five fluoroquinolones. The structures, ranging from 2.4- to 2.6-Å resolution, show that the intrinsically low susceptibility of Mtb to fluoroquinolones correlates with a reduction in contacts to the water shell of an associated magnesium ion, which bridges fluoroquinolone-gyrase interactions. Surprisingly, the structural data revealed few differences in fluoroquinolone-enzyme contacts from drugs that have very different activities against Mtb. By contrast, a stability assay using purified components showed a clear relationship between ternary complex reversibility and inhibitory activities reported with cultured cells. Collectively, our data indicate that the stability of fluoroquinolone/DNA interactions is a major determinant of fluoroquinolone activity and that moieties that have been appended to the C7 position of different quinolone scaffolds do not take advantage of specific contacts that might be made with the enzyme. These concepts point to new approaches for developing quinolone-class compounds that have increased potency against Mtb and the ability to overcome resistance.


    Organizational Affiliation

    Division of Medicinal and Natural Products Chemistry, University of Iowa, Iowa City, IA 52242.,Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine, Baltimore, MD 21205;,Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine, Baltimore, MD 21205; jmberger@jhmi.edu.




Macromolecules

Find similar proteins by: Sequence  |  Structure


Entity ID: 1
MoleculeChainsSequence LengthOrganismDetails
DNA gyrase subunit A
A, C
503Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)Mutation(s): 0 
Gene Names: gyrA
EC: 5.6.2.3
Find proteins for P9WG47 (Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv))
Go to UniProtKB:  P9WG47
Entity ID: 2
MoleculeChainsSequence LengthOrganismDetails
DNA gyrase subunit B
B, D
253Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)Mutation(s): 0 
Gene Names: gyrB
EC: 5.6.2.3
Find proteins for P9WG45 (Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv))
Go to UniProtKB:  P9WG45
Entity ID: 3
MoleculeChainsLengthOrganism
DNA substrate 24-mer GGTCATGAATGACTATGCACGTAAE,H24synthetic construct
Entity ID: 4
MoleculeChainsLengthOrganism
DNA substrate 24-mer TTACGTGCATAGTCATTCATGACCF,G24synthetic construct
Small Molecules
Ligands 2 Unique
IDChainsName / Formula / InChI Key2D Diagram3D Interactions
MG
Query on MG

Download SDF File 
Download CCD File 
B, D, E, F
MAGNESIUM ION
Mg
JLVVSXFLKOJNIY-UHFFFAOYSA-N
 Ligand Interaction
LFX
Query on LFX

Download SDF File 
Download CCD File 
E, F
(3S)-9-fluoro-3-methyl-10-(4-methylpiperazin-1-yl)-7-oxo-2,3-dihydro-7H-[1,4]oxazino[2,3,4-ij]quinoline-6-carboxylic acid
Levofloxacin
C18 H20 F N3 O4
GSDSWSVVBLHKDQ-JTQLQIEISA-N
 Ligand Interaction
Modified Residues  1 Unique
IDChainsTypeFormula2D DiagramParent
PTR
Query on PTR
A, C
L-PEPTIDE LINKINGC9 H12 N O6 PTYR
Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.5 Å
  • R-Value Free: 0.249 
  • R-Value Work: 0.226 
  • Space Group: P 1 21 1
Unit Cell:
Length (Å)Angle (°)
a = 108.094α = 90.00
b = 82.989β = 108.76
c = 129.101γ = 90.00
Software Package:
Software NamePurpose
PHENIXrefinement
PHASERphasing
PDB_EXTRACTdata extraction
Cootmodel building
XSCALEdata scaling
XDSdata reduction

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History & Funding Information

Deposition Data


Funding OrganizationLocationGrant Number
National Institutes of Health/National Cancer InstituteUnited StatesR01-CA077373

Revision History 

  • Version 1.0: 2016-03-02
    Type: Initial release
  • Version 1.1: 2017-09-20
    Type: Author supporting evidence, Database references, Derived calculations