3QYM | pdb_00003qym

Structure of p63 DNA Binding Domain in Complex with a 10 Base Pair A/T Rich Response Element Half Site


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 3.20 Å
  • R-Value Free: 
    0.271 (Depositor), 0.269 (DCC) 
  • R-Value Work: 
    0.245 (Depositor), 0.239 (DCC) 
  • R-Value Observed: 
    0.246 (Depositor) 

Starting Model: experimental
View more details

wwPDB Validation   3D Report Full Report


This is version 1.2 of the entry. See complete history


Literature

Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements.

Chen, C.Gorlatova, N.Kelman, Z.Herzberg, O.

(2011) Proc Natl Acad Sci U S A 108: 6456-6461

  • DOI: https://doi.org/10.1073/pnas.1013657108
  • Primary Citation Related Structures: 
    3QYM, 3QYN

  • PubMed Abstract: 

    Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.


  • Organizational Affiliation
    • William Myron Keck Laboratory for Structural Biology, Institute for Bioscience and Biotechnology Research, University of Maryland, Rockville, MD 20850, USA.

Macromolecules

Find similar proteins by:  (by identity cutoff)  |  3D Structure
Entity ID: 1
MoleculeChains Sequence LengthOrganismDetailsImage
Tumor protein 63
A, B, C, D, E
A, B, C, D, E, F, G, H
203Homo sapiensMutation(s): 0 
Gene Names: KETP63P73HP73LTP63TP73L
UniProt & NIH Common Fund Data Resources
Find proteins for Q9H3D4 (Homo sapiens)
Explore Q9H3D4 
Go to UniProtKB:  Q9H3D4
PHAROS:  Q9H3D4
GTEx:  ENSG00000073282 
Entity Groups  
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupQ9H3D4
Sequence Annotations
Expand
  • Reference Sequence

Find similar nucleic acids by:  Sequence  

Entity ID: 2
MoleculeChains LengthOrganismImage
5'-D(*AP*AP*AP*CP*AP*TP*GP*TP*TP*T)-3'
I, J, K, L, M
I, J, K, L, M, N, O, P
10N/A
Sequence Annotations
Expand
  • Reference Sequence
Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 3.20 Å
  • R-Value Free:  0.271 (Depositor), 0.269 (DCC) 
  • R-Value Work:  0.245 (Depositor), 0.239 (DCC) 
  • R-Value Observed: 0.246 (Depositor) 
Space Group: C 1 2 1
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 123.872α = 90
b = 180.198β = 92.62
c = 104.379γ = 90
Software Package:
Software NamePurpose
JBluIce-EPICSdata collection
PHASERphasing
PHENIXrefinement
XDSdata reduction
XSCALEdata scaling

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2011-04-06
    Type: Initial release
  • Version 1.1: 2011-07-13
    Changes: Version format compliance
  • Version 1.2: 2023-09-13
    Changes: Data collection, Database references, Derived calculations, Refinement description