3QYN

Structure of p63 DNA Binding Domain in Complex with a 22 Base Pair A/T Rich Response Element Containing 2 Base Pair Spacer Between Half Sites


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.5 Å
  • R-Value Free: 0.245 
  • R-Value Work: 0.210 

wwPDB Validation 3D Report Full Report


This is version 1.1 of the entry. See complete history

Literature

Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements.

Chen, C.Gorlatova, N.Kelman, Z.Herzberg, O.

(2011) Proc.Natl.Acad.Sci.USA 108: 6456-6461

  • DOI: 10.1073/pnas.1013657108
  • Primary Citation of Related Structures:  

  • PubMed Abstract: 
  • Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insigh ...

    Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.


    Organizational Affiliation

    William Myron Keck Laboratory for Structural Biology, Institute for Bioscience and Biotechnology Research, University of Maryland, Rockville, MD 20850, USA.




Macromolecules

Find similar proteins by: Sequence  |  Structure


Entity ID: 1
MoleculeChainsSequence LengthOrganismDetails
Tumor protein 63
A, B, C, D
203Homo sapiensMutation(s): 0 
Gene Names: TP63 (KET, P63, P73H, P73L, TP73L)
Find proteins for Q9H3D4 (Homo sapiens)
Go to Gene View: TP63
Go to UniProtKB:  Q9H3D4
Entity ID: 2
MoleculeChainsLengthOrganism
5'-D(*AP*AP*AP*CP*AP*TP*GP*TP*TP*TP*TP*AP*AP*AP*AP*CP*AP*TP*GP*TP*TP*T)-3'E,F22N/A
Small Molecules
Ligands 1 Unique
IDChainsName / Formula / InChI Key2D Diagram3D Interactions
ZN
Query on ZN

Download SDF File 
Download CCD File 
A, B, C, D
ZINC ION
Zn
PTFCDOFLOPIGGS-UHFFFAOYSA-N
 Ligand Interaction
Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.5 Å
  • R-Value Free: 0.245 
  • R-Value Work: 0.210 
  • Space Group: P 63
Unit Cell:
Length (Å)Angle (°)
a = 140.984α = 90.00
b = 140.984β = 90.00
c = 119.346γ = 120.00
Software Package:
Software NamePurpose
JBluIce-EPICSdata collection
PHENIXrefinement
XDSdata reduction
PHASERphasing
XSCALEdata scaling

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History 

Deposition Data

  • Deposited Date: 2011-03-03 
  • Released Date: 2011-04-06 
  • Deposition Author(s): Chen, C., Herzberg, O.

Revision History 

  • Version 1.0: 2011-04-06
    Type: Initial release
  • Version 1.1: 2011-07-13
    Type: Version format compliance