1JU0 | pdb_00001ju0

NMR solution structure of a DNA kissing complex


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 16 
  • Conformers Submitted: 16 
  • Selection Criteria: back calculated data agree with experimental NOESY spectrum, structures with acceptable covalent geometry, structures with the least restraint violations, structures with the lowest energy 

wwPDB Validation   3D Report Full Report


This is version 1.4 of the entry. See complete history


Literature

A new peculiar DNA structure: NMR solution structure of a DNA kissing complex.

Barbault, F.Huynh-Dinh, T.Paoletti, J.Lanceloti, G.

(2002) J Biomol Struct Dyn 19: 649-658

  • DOI: https://doi.org/10.1080/07391102.2002.10506771
  • Primary Citation of Related Structures:  
    1JU0, 1JUA

  • PubMed Abstract: 

    The deoxyoligoribonucleotide d(CTTGCTGAAGCGCGCACGGCAAG) (dSL1) corresponding to the reverse transcripted sequence of the dimerization initiation site SL1 of HIV- 1(Lai) RNA was synthesized using phosphoramidite chemistry. Like its oligoribonucleotide counterpart, dSL1 dimerized spontaneously in solution. Here we report the first NMR solution structure of a kissing complex formed with two DNA strands. The melting point of the DNA dimer (35 degrees C) was found slightly higher than the one of the corresponding RNA dimer (32 degrees C). Despite this only slight difference in melting point, several structural differences were observed between the ribo- and the deoxyribo- dimers. The solution structure of the deoxy- dimer was a symmetric homodimer with a loop-loop interaction stabilized by four central G-C base-pairs, a head to tail A-A base-pair arrangement between the A8 residues of the two strands and a stacking of A9 with C15. As a consequence, G10 was not paired and occupied a position outside the stem and the loop. Each stem was formed by seven base-pairs whose axis made an angle of about 100 degree with the plane of the loops. The distortion of the helix at the junction of the stem and of the loop induced a fold up of the A8pA9 step with a phosphate-phosphate distance lowered to 4.5 A. The plane of the non-canonical A-A base-pair was oriented perpendicularly to the axis of the stems. The four central base-pairs formed an open fan-shaped motif with an angle of 20 degrees between the bases and each of them was oriented perpendicularly to the A8-A8 plane. The deviation of the computed chemical shifts and the experimental ones for the aromatic proton was always less than 0.25ppm for each of the 16 converged solution structures and their average less than 0.1ppm.


  • Organizational Affiliation
    • Centre de Biophysique Moléculaire, Rue Charles Sadron, 45071 Orléans Cedex 02, France.

Macromolecules

Find similar nucleic acids by:  Sequence   |   3D Structure  

Entity ID: 1
MoleculeChains LengthOrganismImage
5'-D(*CP*TP*TP*GP*CP*TP*GP*AP*AP*GP*CP*GP*CP*GP*CP*AP*CP*GP*GP*CP*AP*AP*G)-3'
A, B
23N/A
Sequence Annotations
Expand
  • Reference Sequence
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 16 
  • Conformers Submitted: 16 
  • Selection Criteria: back calculated data agree with experimental NOESY spectrum, structures with acceptable covalent geometry, structures with the least restraint violations, structures with the lowest energy 

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2002-08-23
    Type: Initial release
  • Version 1.1: 2008-04-27
    Changes: Version format compliance
  • Version 1.2: 2011-07-13
    Changes: Version format compliance
  • Version 1.3: 2022-02-23
    Changes: Data collection, Database references, Derived calculations
  • Version 1.4: 2024-05-22
    Changes: Data collection