5E3O
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
X-RAY DIFFRACTION
Crystallization
Crystalization Experiments | ||||
---|---|---|---|---|
ID | Method | pH | Temperature | Details |
1 | VAPOR DIFFUSION, HANGING DROP | 8.5 | 277 | 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400 |
Crystal Properties | |
---|---|
Matthews coefficient | Solvent content |
4.02 | 69.41 |
Crystal Data
Unit Cell | |
---|---|
Length ( Å ) | Angle ( ˚ ) |
a = 43.19 | α = 90 |
b = 94.32 | β = 90 |
c = 154.34 | γ = 90 |
Symmetry | |
---|---|
Space Group | P 21 21 21 |
Diffraction
Diffraction Experiment | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Crystal ID | Scattering Type | Data Collection Temperature | Detector | Detector Type | Details | Collection Date | Monochromator | Protocol | |||||
1 | 1 | x-ray | 100 | CCD | ADSC QUANTUM 315 | 2011-03-05 | M | SINGLE WAVELENGTH |
Radiation Source | |||||
---|---|---|---|---|---|
ID # | Source | Type | Wavelength List | Synchrotron Site | Beamline |
1 | SYNCHROTRON | APS BEAMLINE 24-ID-C | 0.97949 | APS | 24-ID-C |
Data Collection
Overall | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Resolution (High) | Resolution (Low) | Percent Possible (Observed) | R Merge I (Observed) | Rpim I (All) | CC (Half) | Net I Over Average Sigma (I) | Redundancy | Number Reflections (All) | Number Reflections (Observed) | Observed Criterion Sigma (F) | Observed Criterion Sigma (I) | B (Isotropic) From Wilson Plot | ||||||
1 | 2.78 | 80.48 | 94.3 | 0.071 | 0.035 | 0.998 | 13.8 | 5.1 | 15712 | 39.23 |
Highest Resolution Shell | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Resolution (High) | Resolution (Low) | Percent Possible (All) | Percent Possible (Observed) | R Merge I (Observed) | Rpim I (All) | CC (Half) | Mean I Over Sigma (Observed) | Redundancy | Number Unique Reflections (All) | |||||||||
1 | 2.78 | 2.93 | 99.9 | 0.719 | 0.349 | 0.862 | 2.6 | 5.3 | 2372 |
Refinement
Statistics | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction ID | Structure Solution Method | Cross Validation method | Resolution (High) | Resolution (Low) | Cut-off Sigma (F) | Number Reflections (Observed) | Number Reflections (R-Free) | Percent Reflections (Observed) | R-Factor (Observed) | R-Work | R-Free | Mean Isotropic B | |||||||
X-RAY DIFFRACTION | MOLECULAR REPLACEMENT | FREE R-VALUE | 2.78 | 59.727 | 1.34 | 14420 | 711 | 86.77 | 0.2222 | 0.2199 | 0.2667 | 43.9852 |
Temperature Factor Modeling | ||||||
---|---|---|---|---|---|---|
Anisotropic B[1][1] | Anisotropic B[1][2] | Anisotropic B[1][3] | Anisotropic B[2][2] | Anisotropic B[2][3] | Anisotropic B[3][3] | |
RMS Deviations | |
---|---|
Key | Refinement Restraint Deviation |
f_dihedral_angle_d | 24.417 |
f_angle_d | 0.804 |
f_chiral_restr | 0.031 |
f_bond_d | 0.005 |
f_plane_restr | 0.004 |
Non-Hydrogen Atoms Used in Refinement | |
---|---|
Non-Hydrogen Atoms | Number |
Protein Atoms | 1505 |
Nucleic Acid Atoms | 1101 |
Solvent Atoms | 8 |
Heterogen Atoms |
Software
Software | |
---|---|
Software Name | Purpose |
Aimless | data scaling |
PHASER | phasing |
PHENIX | refinement |
PDB_EXTRACT | data extraction |