Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
External Resource: Annotation
| Chains | Type | Family Name | Domain Identifier | Family Identifier | Provenance Source (Version) |
| B | SCOP2B Superfamily | Homeodomain-like | 8002272 | 3000001 | SCOP2B (2022-06-29) |
| A | SCOP2B Superfamily | Homeodomain-like | 8002272 | 3000001 | SCOP2B (2022-06-29) |
| Chains | Family Name | Domain Identifier | Architecture | Possible Homology | Homology | Topology | Family | Provenance Source (Version) |
| B | Como_SCP | e5e3oB1 | A: a/b three-layered sandwiches | X: HTH | H: Baseplate wedge protein gp6 helical domain | T: Baseplate wedge protein gp6 helical domain | F: Como_SCP | ECOD (v294.1) |
| A | Como_SCP | e5e3oA1 | A: a/b three-layered sandwiches | X: HTH | H: Baseplate wedge protein gp6 helical domain | T: Baseplate wedge protein gp6 helical domain | F: Como_SCP | ECOD (v294.1) |
| Chains | Polymer | Molecular Function | Biological Process | Cellular Component |
|---|
| DNA (27-MER) | - | - | - |
| DNA (27-MER) | - | - | - |
| DNA-binding protein Fis | | | |