5DS9 | pdb_00005ds9

Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)

External Resource: Annotation

Domain Annotation: SCOP2 Classification
Domain Annotation: ECOD Classification
Domain Annotation: CATH
Protein Family Annotation
Gene Ontology: Gene Product Annotation
InterPro: Protein Family Classification

Domain Annotation: SCOP2 Classification SCOP2 Database Homepage

Chains	Type	Family Name	Domain Identifier	Family Identifier	Provenance Source (Version)
A	SCOP2B Superfamily	Homeodomain-like	8002272	3000001	SCOP2B (2022-06-29)
B	SCOP2B Superfamily	Homeodomain-like	8002272	3000001	SCOP2B (2022-06-29)

Domain Annotation: ECOD Classification ECOD Database Homepage

Chains	Family Name	Domain Identifier	Architecture	Possible Homology	Homology	Topology	Family	Provenance Source (Version)
A	Glyco_hydro_31_2nd	e5ds9A1	A: a/b three-layered sandwiches	X: Rossmann-like	H: RIFT-related	T: acid protease	F: Glyco_hydro_31_2nd	ECOD (v294.1)
B	Glyco_hydro_31_2nd	e5ds9B1	A: a/b three-layered sandwiches	X: Rossmann-like	H: RIFT-related	T: acid protease	F: Glyco_hydro_31_2nd	ECOD (v294.1)

Domain Annotation: CATH CATH Database Homepage

Chain	Domain	Class	Architecture	Topology	Homology	Provenance Source (Version)
A	1.10.10.60	Mainly Alpha	Orthogonal Bundle	Arc Repressor Mutant, subunit A	Homeodomain-like	CATH (4.3.0)
B	1.10.10.60	Mainly Alpha	Orthogonal Bundle	Arc Repressor Mutant, subunit A	Homeodomain-like	CATH (4.3.0)

Protein Family Annotation Pfam Database Homepage

Chains	Accession	Name	Description	Comments	Source
A, B	PF02954	Bacterial regulatory protein, Fis family (HTH_8)	Bacterial regulatory protein, Fis family		Domain

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

Chains	Polymer	Molecular Function	Biological Process	Cellular Component
D	DNA (27-MER)	-	-	-
C	DNA (27-MER)	-	-	-
A, B	DNA-binding protein Fis	DNA binding binding nucleic acid binding identical protein binding protein binding protein homodimerization activity protein dimerization activity sequence-specific DNA binding sequence-specific double-stranded DNA binding transcription cis-regulatory region binding double-stranded DNA binding transcription regulatory region nucleic acid binding DNA binding, bending sequence-specific DNA binding, bending DNA binding binding nucleic acid binding identical protein binding protein binding protein homodimerization activity protein dimerization activity sequence-specific DNA binding sequence-specific double-stranded DNA binding transcription cis-regulatory region binding double-stranded DNA binding transcription regulatory region nucleic acid binding DNA binding, bending sequence-specific DNA binding, bending core promoter sequence-specific DNA binding transcription regulator activity DNA-binding transcription factor activity DNA-binding transcription activator activity DNA-binding transcription repressor activity	regulation of cellular process RNA metabolic process regulation of primary metabolic process nucleobase-containing compound metabolic process RNA biosynthetic process nucleic acid biosynthetic process DNA-templated transcription regulation of RNA metabolic process regulation of nucleobase-containing compound metabolic process regulation of RNA biosynthetic process regulation of biosynthetic process regulation of biological process biological regulation primary metabolic process regulation of cellular process RNA metabolic process regulation of primary metabolic process nucleobase-containing compound metabolic process RNA biosynthetic process nucleic acid biosynthetic process DNA-templated transcription regulation of RNA metabolic process regulation of nucleobase-containing compound metabolic process regulation of RNA biosynthetic process regulation of biosynthetic process regulation of biological process biological regulation primary metabolic process regulation of macromolecule metabolic process nucleobase-containing compound biosynthetic process gene expression macromolecule biosynthetic process nucleic acid metabolic process regulation of gene expression biosynthetic process cellular process metabolic process regulation of macromolecule biosynthetic process regulation of DNA-templated transcription macromolecule metabolic process regulation of metabolic process regulation of DNA recombination positive regulation of biological process positive regulation of metabolic process positive regulation of macromolecule metabolic process positive regulation of cellular process positive regulation of DNA recombination DNA recombination DNA metabolic process positive regulation of DNA metabolic process regulation of DNA metabolic process cellular component organization organelle organization chromosome organization cellular component organization or biogenesis response to stimulus response to radiation response to abiotic stimulus provirus excision latent virus replication viral latency viral process release from viral latency	protein-containing complex catalytic complex invertasome intracellular protein-containing complex cellular anatomical structure intracellular anatomical structure cytoplasm cytosol protein-DNA complex nucleosome intracellular membraneless organelle chromatin chromosome intracellular organelle protein-containing complex catalytic complex invertasome intracellular protein-containing complex cellular anatomical structure intracellular anatomical structure cytoplasm cytosol protein-DNA complex nucleosome intracellular membraneless organelle chromatin chromosome intracellular organelle organelle membraneless organelle nucleoid

InterPro: Protein Family Classification InterPro Database Homepage

Chains	Accession	Name	Type
A, B	IPR009057	Homedomain-like superfamily	Homologous Superfamily
A, B	IPR002197	DNA binding HTH domain, Fis-type	Domain
A, B	IPR050207	Trans_regulatory_Fis	Unknown
A, B	IPR005412	DNA-binding protein Fis	Family

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM157729. RCSB PDB uses resources of the National Energy Research Scientific Computing Center (NERSC), a Department of Energy User Facility.