5E3L

Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)


Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.


Version NumberVersion DateVersion Type/Reason Version ChangeRevised CIF Category
1.02016-03-23Initial release
1.12024-03-06Data collection, Database references, Derived calculationschem_comp_atom, chem_comp_bond, database_2, diffrn_radiation_wavelength, pdbx_prerelease_seq, pdbx_struct_oper_list Download