5E3L
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
X-RAY DIFFRACTION
Crystallization
Crystalization Experiments | ||||
---|---|---|---|---|
ID | Method | pH | Temperature | Details |
1 | VAPOR DIFFUSION, HANGING DROP | 8.5 | 277 | 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400 |
Crystal Properties | |
---|---|
Matthews coefficient | Solvent content |
4 | 69.28 |
Crystal Data
Unit Cell | |
---|---|
Length ( Å ) | Angle ( ˚ ) |
a = 43.35 | α = 90 |
b = 93.37 | β = 90 |
c = 154.68 | γ = 90 |
Symmetry | |
---|---|
Space Group | P 21 21 21 |
Diffraction
Diffraction Experiment | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Crystal ID | Scattering Type | Data Collection Temperature | Detector | Detector Type | Details | Collection Date | Monochromator | Protocol | |||||
1 | 1 | x-ray | 100 | CCD | ADSC QUANTUM 315 | 2010-10-17 | M | SINGLE WAVELENGTH |
Radiation Source | |||||
---|---|---|---|---|---|
ID # | Source | Type | Wavelength List | Synchrotron Site | Beamline |
1 | SYNCHROTRON | APS BEAMLINE 24-ID-C | 0.97949 | APS | 24-ID-C |
Data Collection
Overall | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Resolution (High) | Resolution (Low) | Percent Possible (Observed) | R Merge I (Observed) | Rpim I (All) | CC (Half) | Net I Over Average Sigma (I) | Redundancy | Number Reflections (All) | Number Reflections (Observed) | Observed Criterion Sigma (F) | Observed Criterion Sigma (I) | B (Isotropic) From Wilson Plot | ||||||
1 | 2.66 | 154.68 | 93.7 | 0.083 | 0.04 | 0.997 | 11.3 | 4.8 | 17612 | 36.79 |
Highest Resolution Shell | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Resolution (High) | Resolution (Low) | Percent Possible (All) | Percent Possible (Observed) | R Merge I (Observed) | Rpim I (All) | CC (Half) | Mean I Over Sigma (Observed) | Redundancy | Number Unique Reflections (All) | |||||||||
1 | 2.66 | 2.8 | 97.2 | 0.67 | 0.312 | 0.903 | 2.4 | 5 | 2586 |
Refinement
Statistics | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction ID | Structure Solution Method | Cross Validation method | Resolution (High) | Resolution (Low) | Cut-off Sigma (F) | Number Reflections (Observed) | Number Reflections (R-Free) | Percent Reflections (Observed) | R-Factor (Observed) | R-Work | R-Free | Mean Isotropic B | |||||||
X-RAY DIFFRACTION | MOLECULAR REPLACEMENT | FREE R-VALUE | 2.66 | 59.561 | 1.33 | 17270 | 1729 | 91.61 | 0.214 | 0.2099 | 0.249 | 54.6968 |
Temperature Factor Modeling | ||||||
---|---|---|---|---|---|---|
Anisotropic B[1][1] | Anisotropic B[1][2] | Anisotropic B[1][3] | Anisotropic B[2][2] | Anisotropic B[2][3] | Anisotropic B[3][3] | |
RMS Deviations | |
---|---|
Key | Refinement Restraint Deviation |
f_dihedral_angle_d | 24.851 |
f_angle_d | 0.954 |
f_chiral_restr | 0.036 |
f_bond_d | 0.005 |
f_plane_restr | 0.004 |
Non-Hydrogen Atoms Used in Refinement | |
---|---|
Non-Hydrogen Atoms | Number |
Protein Atoms | 1505 |
Nucleic Acid Atoms | 1101 |
Solvent Atoms | 4 |
Heterogen Atoms |
Software
Software | |
---|---|
Software Name | Purpose |
Aimless | data scaling |
PHASER | phasing |
PHENIX | refinement |
PDB_EXTRACT | data extraction |
XDS | data reduction |