Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA
Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.
| Version Number | Version Date | Version Type/Reason | Version Change | Revised CIF Category | |
|---|---|---|---|---|---|
| 1.0 | 2026-02-18 | Initial release | Download |
