Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.
| Version Number | Version Date | Version Type/Reason | Version Change | Revised CIF Category | |
|---|---|---|---|---|---|
| 1.0 | 2013-05-01 | Initial release | |||
| 1.1 | 2013-05-22 | Database references | |||
| 1.2 | 2013-07-31 | Database references | |||
| 1.3 | 2023-09-20 | Data collection, Database references, Refinement description | chem_comp_atom, chem_comp_bond, database_2, pdbx_initial_refinement_model | Download |














