1QWB | pdb_00001qwb

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12


Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.


Version NumberVersion DateVersion Type/Reason Version ChangeRevised CIF Category
1.02003-11-25Initial release
1.12008-04-29Version format compliance
1.22011-07-13Version format compliance
1.32020-09-09Data collection, Derived calculations, Structure summaryndb_struct_conf_na, ndb_struct_na_base_pair, ndb_struct_na_base_pair_step, pdbx_nmr_software, pdbx_struct_assembly, pdbx_struct_oper_list, struct, struct_conn
1.42024-05-01Data collection, Database referenceschem_comp_atom, chem_comp_bond, database_2 Download