7OTB | pdb_00007otb

Ruthenium polypridyl complex bound to a unimolecular chair-form G-quadruplex


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 1.60 Å
  • R-Value Free: 
    0.181 (Depositor), 0.196 (DCC) 
  • R-Value Work: 
    0.165 (Depositor), 0.177 (DCC) 
  • R-Value Observed: 
    0.166 (Depositor) 

wwPDB Validation 3D Report Full Report

Validation slider image for 7OTB

Ligand Structure Quality Assessment 


This is version 2.0 of the entry. See complete history

Literature

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

McQuaid, K.T.Takahashi, S.Baumgaertner, L.Cardin, D.J.Paterson, N.G.Hall, J.P.Sugimoto, N.Cardin, C.J.

(2022) J Am Chem Soc 144: 5956-5964

  • DOI: https://doi.org/10.1021/jacs.2c00178
  • Primary Citation Related Structures: 
    7OTB

  • PubMed Abstract: 

    The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen) 2 (qdppz)] 2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG ( htel21 T 18 ), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T 10 -T 11 -A 12 . The two remaining wide lateral loops are linked through a third K + ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.


  • Organizational Affiliation
    • Department of Chemistry, University of Reading, Whiteknights, Reading RG6 6AD, U.K.

Macromolecule Content 

  • Total Structure Weight: 7.83 kDa 
  • Atom Count: 731 
  • Modeled Residue Count: 21 
  • Deposited Residue Count: 21 
  • Unique nucleic acid chains: 1

Macromolecules

Find similar nucleic acids by:  Sequence
Entity ID: 1
MoleculeChains LengthOrganismImage
DNA (5'-D(*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*TP*GP*GP*G)-3')21synthetic construct
Sequence Annotations
Expand
Reference Sequence

Small Molecules

Ligands 3 Unique
IDChains Name / Formula / InChI Key2D Diagram3D Interactions
0K8
(Subject of Investigation/LOI)

Query on 0K8



Download:Ideal Coordinates CCD File
G [auth A]Ruthenium bis-(phenanthroline) 12,17-dihydro-naphthodipyridophenazine-12,17-dione
C50 H28 N8 O2 Ru
LEJPQQFNZLHEQD-UHFFFAOYSA-N
BA

Query on BA



Download:Ideal Coordinates CCD File
F [auth A]BARIUM ION
Ba
XDFCIPNJCBUZJN-UHFFFAOYSA-N
K

Query on K



Download:Ideal Coordinates CCD File
B [auth A],
C [auth A],
D [auth A],
E [auth A]
POTASSIUM ION
K
NPYPAHLBTDXSSS-UHFFFAOYSA-N

Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 1.60 Å
  • R-Value Free:  0.181 (Depositor), 0.196 (DCC) 
  • R-Value Work:  0.165 (Depositor), 0.177 (DCC) 
  • R-Value Observed: 0.166 (Depositor) 
Space Group: P 32 2 1
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 29.68α = 90
b = 29.68β = 90
c = 113.98γ = 120
Software Package:
Software NamePurpose
PHENIXrefinement
PDB_EXTRACTdata extraction
xia2data reduction
XDSdata reduction
xia2data scaling
XSCALEdata scaling
SHELXDEphasing
Cootmodel building

Structure Validation

View Full Validation Report



Ligand Structure Quality Assessment 


Entry History 

& Funding Information

Deposition Data


Funding OrganizationLocationGrant Number
Biotechnology and Biological Sciences Research Council (BBSRC)United KingdomBB/T008342/1

Revision History  (Full details and data files)

  • Version 1.0: 2022-04-06
    Type: Initial release
  • Version 1.1: 2022-04-20
    Changes: Database references
  • Version 1.2: 2024-06-19
    Changes: Data collection
  • Version 2.0: 2026-09-02
    Type: Remediation
    Reason: Metalloprotein remediation
    Changes: Derived calculations, Non-polymer description, Structure summary