6L8M | pdb_00006l8m

WNT DNA promoter mutant G-quadruplex


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the lowest energy 

wwPDB Validation   3D Report Full Report


This is version 1.4 of the entry. See complete history


Literature

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Wang, Z.F.Li, M.H.Chu, I.T.Winnerdy, F.R.Phan, A.T.Chang, T.C.

(2020) Nucleic Acids Res 48: 1120-1130

  • DOI: https://doi.org/10.1093/nar/gkz1207
  • Primary Citation of Related Structures:  
    6L8M, 6L92

  • PubMed Abstract: 

    Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.


  • Organizational Affiliation
    • Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei 106, Taiwan, R.O.C.

Macromolecules

Find similar nucleic acids by:  Sequence  

Entity ID: 1
MoleculeChains LengthOrganismImage
DNA (5'-D(*GP*GP*GP*TP*CP*AP*CP*CP*GP*GP*GP*CP*AP*GP*TP*GP*GP*GP*CP*GP*GP*G)-3')22Homo sapiens
Sequence Annotations
Expand
  • Reference Sequence
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the lowest energy 

Structure Validation

View Full Validation Report



Entry History & Funding Information

Deposition Data


Funding OrganizationLocationGrant Number
Academia Sinica (Taiwan)Taiwan--

Revision History  (Full details and data files)

  • Version 1.0: 2019-12-11
    Type: Initial release
  • Version 1.1: 2020-01-29
    Changes: Database references
  • Version 1.2: 2020-03-04
    Changes: Database references
  • Version 1.3: 2023-06-14
    Changes: Database references, Other
  • Version 1.4: 2024-05-15
    Changes: Data collection, Database references