6L92

A basket type G-quadruplex in WNT DNA promoter

• PDB DOI: https://doi.org/10.2210/pdb6L92/pdb
• NAKB: 6L92

• Classification: DNA
• Organism(s): Homo sapiens
• Mutation(s): No 


• Deposited: 2019-11-08 Released: 2019-12-11 
• Deposition Author(s): Wang, Z.F., Li, M.H., Chu, I.T., Winnerdy, F.R., Phan, A.T., Chang, T.C.
• Funding Organization(s): Academia Sinica (Taiwan)

---

Experimental Data Snapshot

• Method: SOLUTION NMR
• Conformers Calculated: 100 
• Conformers Submitted: 10 
• Selection Criteria: structures with the lowest energy 

Literature

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Wang, Z.F., Li, M.H., Chu, I.T., Winnerdy, F.R., Phan, A.T., Chang, T.C.

(2020) Nucleic Acids Res 48: 1120-1130

• PubMed: 31912153 
• DOI: https://doi.org/10.1093/nar/gkz1207
• Primary Citation of Related Structures:  
  6L8M, 6L92


• PubMed Abstract: 
  

  Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

---

Organizational Affiliation: 

Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei 106, Taiwan, R.O.C.

Biological Assembly 1  

Biological assembly 1 assigned by authors.

Biological Assembly Evidence: native gel electrophoresis

Macromolecule Content

• Total Structure Weight: 6.9 kDa 
• Atom Count: 459 
• Modelled Residue Count: 22 
• Deposited Residue Count: 22 
• Unique nucleic acid chains: 1

Macromolecules

Entity ID: 1
Molecule	Chains	Length	Organism	Image
DNA (5'-D(*GP*GP*GP*CP*CP*AP*CP*CP*GP*GP*GP*CP*AP*GP*TP*GP*GP*GP*CP*GP*GP*G)-3')	A	22	Homo sapiens

Experimental Data & Validation

Experimental Data

• Method: SOLUTION NMR
• Conformers Calculated: 100 
• Conformers Submitted: 10 
• Selection Criteria: structures with the lowest energy 

Structure Validation

Entry History & Funding Information

Deposition Data

• Released Date: 2019-12-11 
Deposition Author(s): Wang, Z.F., Li, M.H., Chu, I.T., Winnerdy, F.R., Phan, A.T., Chang, T.C.

---

Funding Organization	Location	Grant Number
Academia Sinica (Taiwan)	Taiwan	--

Revision History  

• Version 1.0: 2019-12-11
  Type: Initial release
  
• Version 1.1: 2020-01-29
  Changes: Database references
• Version 1.2: 2020-03-04
  Changes: Database references
• Version 1.3: 2023-06-14
  Changes: Database references, Other