Protein structure
Elkayam, E., Joshua-Tor, L.To be published.
Experimental Data Snapshot
Starting Model: experimental
View more details
wwPDB Validation   3D Report Full Report
Entity ID: 2 | |||||
|---|---|---|---|---|---|
| Molecule | Chains | Sequence Length | Organism | Details | Image |
| Protein argonaute-2 | B [auth A] | 861 | Homo sapiens | Mutation(s): 2  Gene Names: AGO2, EIF2C2 EC: 3.1.26 | ![]() |
UniProt & NIH Common Fund Data Resources | |||||
Find proteins for Q9UKV8 (Homo sapiens) Explore Q9UKV8  Go to UniProtKB:  Q9UKV8 | |||||
PHAROS:  Q9UKV8 GTEx:  ENSG00000123908  | |||||
Entity Groups   | |||||
| Sequence Clusters | 30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity | ||||
| UniProt Group | Q9UKV8 | ||||
Sequence AnnotationsExpand | |||||
| |||||
Find similar nucleic acids by: Sequence
Entity ID: 1 | |||||
|---|---|---|---|---|---|
| Molecule | Chains | Length | Organism | Image | |
| RNA (UVP)UAUAGAGCAAGAACACUGUU | A [auth R] | 21 | Mus musculus | ![]() | |
Sequence AnnotationsExpand | |||||
| |||||
| Ligands 1 Unique | |||||
|---|---|---|---|---|---|
| ID | Chains | Name / Formula / InChI Key | 2D Diagram | 3D Interactions | |
| IPH Query on IPH | C [auth A], D [auth A] | PHENOL C6 H6 O ISWSIDIOOBJBQZ-UHFFFAOYSA-N | |||
| Length ( Å ) | Angle ( ˚ ) |
|---|---|
| a = 63.207 | α = 90 |
| b = 108.306 | β = 106.62 |
| c = 68.821 | γ = 90 |
| Software Name | Purpose |
|---|---|
| PHENIX | refinement |
| XDS | data reduction |
| SCALA | data scaling |
| PHASER | phasing |
| Funding Organization | Location | Grant Number |
|---|---|---|
| Howard Hughes Medical Institute (HHMI) | United States | -- |