Protein structure
Elkayam, E., Joshua-Tor, L.To be published.
Experimental Data Snapshot
wwPDB Validation   3D Report Full Report
Entity ID: 2 | |||||
---|---|---|---|---|---|
Molecule | Chains | Sequence Length | Organism | Details | Image |
Protein argonaute-2 | B [auth A] | 861 | Homo sapiens | Mutation(s): 2  Gene Names: AGO2, EIF2C2 EC: 3.1.26 | ![]() |
UniProt & NIH Common Fund Data Resources | |||||
Find proteins for Q9UKV8 (Homo sapiens) Explore Q9UKV8  Go to UniProtKB:  Q9UKV8 | |||||
PHAROS:  Q9UKV8 | |||||
Entity Groups   | |||||
Sequence Clusters | 30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity | ||||
UniProt Group | Q9UKV8 | ||||
Protein Feature ViewExpand | |||||
|
Find similar nucleic acids by: Sequence | 3D Structure
Entity ID: 1 | |||||
---|---|---|---|---|---|
Molecule | Chains | Length | Organism | Image | |
RNA (UVP)UAUAGAGCAAGAACACUGUU | A [auth R] | 21 | Mus musculus | ![]() | |
Protein Feature ViewExpand | |||||
|
Ligands 1 Unique | |||||
---|---|---|---|---|---|
ID | Chains | Name / Formula / InChI Key | 2D Diagram | 3D Interactions | |
IPH Query on IPH | C [auth A], D [auth A] | PHENOL C6 H6 O ISWSIDIOOBJBQZ-UHFFFAOYSA-N | Ligand Interaction |
Length ( Å ) | Angle ( ˚ ) |
---|---|
a = 63.207 | α = 90 |
b = 108.306 | β = 106.62 |
c = 68.821 | γ = 90 |
Software Name | Purpose |
---|---|
PHENIX | refinement |
XDS | data reduction |
SCALA | data scaling |
PHASER | phasing |
Funding Organization | Location | Grant Number |
---|---|---|
Howard Hughes Medical Institute (HHMI) | United States | -- |