5T7B

Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.53 Å
  • R-Value Free: 0.238 
  • R-Value Work: 0.194 
  • R-Value Observed: 0.196 

wwPDB Validation   3D Report Full Report


This is version 1.1 of the entry. See complete history


Literature

Protein structure

Elkayam, E.Joshua-Tor, L.

To be published.

Macromolecules

Find similar proteins by:  (by identity cutoff)  |  Structure
Entity ID: 2
MoleculeChainsSequence LengthOrganismDetailsImage
Protein argonaute-2B [auth A]861Homo sapiensMutation(s): 2 
Gene Names: AGO2EIF2C2
EC: 3.1.26
Find proteins for Q9UKV8 (Homo sapiens)
Explore Q9UKV8 
Go to UniProtKB:  Q9UKV8
NIH Common Fund Data Resources
PHAROS:  Q9UKV8
Protein Feature View
Expand
  • Reference Sequence
Find similar nucleic acids by:  (by identity cutoff)  |  Structure
Entity ID: 1
MoleculeChainsLengthOrganismImage
RNA (UVP)UAUAGAGCAAGAACACUGUUA [auth R]21Mus musculus
Small Molecules
Ligands 1 Unique
IDChainsName / Formula / InChI Key2D Diagram3D Interactions
IPH
Query on IPH

Download Ideal Coordinates CCD File 
C [auth A], D [auth A]PHENOL
C6 H6 O
ISWSIDIOOBJBQZ-UHFFFAOYSA-N
 Ligand Interaction
Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.53 Å
  • R-Value Free: 0.238 
  • R-Value Work: 0.194 
  • R-Value Observed: 0.196 
  • Space Group: P 1 21 1
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 63.207α = 90
b = 108.306β = 106.62
c = 68.821γ = 90
Software Package:
Software NamePurpose
PHENIXrefinement
XDSdata reduction
SCALAdata scaling
PHASERphasing

Structure Validation

View Full Validation Report



Entry History & Funding Information

Deposition Data


Funding OrganizationLocationGrant Number
Howard Hughes Medical Institute (HHMI)United States--

Revision History  (Full details and data files)

  • Version 1.0: 2016-12-14
    Type: Initial release
  • Version 1.1: 2019-11-20
    Changes: Author supporting evidence