5J6U

DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 11 
  • Selection Criteria: structures with the lowest energy 

wwPDB Validation 3D Report Full Report


This is version 1.1 of the entry. See complete history

Literature

DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium

Dvorkin, S.A.Karsisiotis, A.I.Webba da Silva, M.

To be published.

Macromolecules

Find similar proteins by: Sequence  |  Structure

Entity ID: 1
MoleculeChainsLengthOrganism
DNA (25-MER)A25unidentified
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 11 
  • Selection Criteria: structures with the lowest energy 

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History & Funding Information

Deposition Data


Funding OrganizationCountryGrant Number
Biotechnology and Biological Sciences Research CouncilUnited KingdomBB/H005692
Wellcome TrustUnited Kingdom083796/Z/07/Z

Revision History 

  • Version 1.0: 2017-05-10
    Type: Initial release
  • Version 1.1: 2017-08-30
    Type: Author supporting evidence, Derived calculations