Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Experimental Data Snapshot

  • Resolution: 2.72 Å
  • R-Value Free: 0.258 
  • R-Value Work: 0.217 
  • R-Value Observed: 0.221 

wwPDB Validation 3D Report Full Report

This is version 1.2 of the entry. See complete history


Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.

Hancock, S.P.Ghane, T.Cascio, D.Rohs, R.Di Felice, R.Johnson, R.C.

(2013) Nucleic Acids Res 41: 6750-6760

  • DOI: 10.1093/nar/gkt357
  • Structures With Same Primary Citation

  • PubMed Abstract: 
  • The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis-DNA complex narrows to about half the mean minor groove width of ca ...

    The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis-DNA complex narrows to about half the mean minor groove width of canonical B-form DNA to fit onto the protein surface. G/C base pairs within this segment, which is not contacted by the Fis protein, reduce binding affinities up to 2000-fold over A/T-rich sequences. We show here through multiple X-ray structures and binding properties of Fis-DNA complexes containing base analogs that the 2-amino group on guanine is the primary molecular determinant controlling minor groove widths. Molecular dynamics simulations of free-DNA targets with canonical and modified bases further demonstrate that sequence-dependent narrowing of minor groove widths is modulated almost entirely by the presence of purine 2-amino groups. We also provide evidence that protein-mediated phosphate neutralization facilitates minor groove compression and is particularly important for binding to non-optimally shaped DNA duplexes.

    Organizational Affiliation

    Department of Biological Chemistry, David Geffen School of Medicine at the University of California at Los Angeles, Los Angeles, CA 90095-1737, USA.


Find similar proteins by: Sequence  |  Structure

Entity ID: 1
MoleculeChainsSequence LengthOrganismDetails
DNA-binding protein fis
A, B
98Escherichia coli K-12Mutation(s): 0 
Gene Names: ECDH1ME8569_3147EcDH1_0445fis
Protein Feature View is not available: No corresponding UniProt sequence found.

Find similar nucleic acids by: Sequence  |  Structure

Entity ID: 2
27-bp DNA Strand AC27N/A

Find similar nucleic acids by: Sequence  |  Structure

Entity ID: 3
27-bp DNA Strand BD27N/A
Experimental Data & Validation

Experimental Data

  • Resolution: 2.72 Å
  • R-Value Free: 0.258 
  • R-Value Work: 0.217 
  • R-Value Observed: 0.221 
  • Space Group: P 21 21 21
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 42.79α = 90
b = 89.39β = 90
c = 154.15γ = 90
Software Package:
Software NamePurpose
XSCALEdata scaling
PDB_EXTRACTdata extraction
XDSdata reduction

Structure Validation

View Full Validation Report

Entry History 

Deposition Data

Revision History 

  • Version 1.0: 2013-05-01
    Type: Initial release
  • Version 1.1: 2013-05-22
    Changes: Database references
  • Version 1.2: 2013-07-31
    Changes: Database references