4H29 | pdb_00004h29

B-raf dimer DNA quadruplex


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 1.99 Å
  • R-Value Free: 
    0.242 (Depositor), 0.234 (DCC) 
  • R-Value Work: 
    0.213 (Depositor), 0.203 (DCC) 
  • R-Value Observed: 
    0.214 (Depositor) 

wwPDB Validation 3D Report Full Report

Validation slider image for 4H29

This is version 1.2 of the entry. See complete history

Literature

Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex.

Wei, D.Todd, A.K.Zloh, M.Gunaratnam, M.Parkinson, G.N.Neidle, S.

(2013) J Am Chem Soc 135: 19319-19329

  • DOI: https://doi.org/10.1021/ja4101358
  • Primary Citation Related Structures: 
    4H29

  • PubMed Abstract: 

    The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.


  • Organizational Affiliation
    • UCL School of Pharmacy, University College London , London WC1N 1AX, United Kingdom.

Macromolecule Content 

  • Total Structure Weight: 13.1 kDa 
  • Atom Count: 898 
  • Modeled Residue Count: 40 
  • Deposited Residue Count: 40 
  • Unique nucleic acid chains: 1

Macromolecules

Find similar nucleic acids by:  Sequence
Entity ID: 1
MoleculeChains LengthOrganismImage
DNA (5'-D(*GP*GP*GP*CP*GP*GP*GP*GP*AP*GP*GP*GP*GP*GP*AP*AP*GP*GP*GP*A)-3')
A, B
20Homo sapiens
Sequence Annotations
Expand
Reference Sequence

Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 1.99 Å
  • R-Value Free:  0.242 (Depositor), 0.234 (DCC) 
  • R-Value Work:  0.213 (Depositor), 0.203 (DCC) 
  • R-Value Observed: 0.214 (Depositor) 
Space Group: C 2 2 21
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 33.46α = 90
b = 47.68β = 90
c = 137.32γ = 90
Software Package:
Software NamePurpose
xia2data scaling
PHASESphasing
REFMACrefinement
xia2data reduction
SCALAdata scaling

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2013-07-31
    Type: Initial release
  • Version 1.1: 2014-01-08
    Changes: Database references
  • Version 1.2: 2024-02-28
    Changes: Data collection, Database references, Derived calculations