4H29

B-raf dimer DNA quadruplex


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 1.991 Å
  • R-Value Free: 0.242 
  • R-Value Work: 0.213 

wwPDB Validation 3D Report Full Report


This is version 1.1 of the entry. See complete history

Literature

Crystal Structure of a Promoter Sequence in the B-raf Gene Reveals an Intertwined Dimer Quadruplex.

Wei, D.Todd, A.K.Zloh, M.Gunaratnam, M.Parkinson, G.N.Neidle, S.

(2013) J.Am.Chem.Soc. 135: 19319-19329

  • DOI: 10.1021/ja4101358

  • PubMed Abstract: 
  • The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninte ...

    The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.


    Organizational Affiliation

    UCL School of Pharmacy, University College London , London WC1N 1AX, United Kingdom.




Macromolecules

Find similar proteins by: Sequence  |  Structure

Entity ID: 1
MoleculeChainsLengthOrganism
DNA (5'-D(*GP*GP*GP*CP*GP*GP*GP*GP*AP*GP*GP*GP*GP*GP*AP*AP*GP*GP*GP*A)-3')A,B20Homo sapiens
Small Molecules
Ligands 1 Unique
IDChainsName / Formula / InChI Key2D Diagram3D Interactions
K
Query on K

Download SDF File 
Download CCD File 
A, B
POTASSIUM ION
K
NPYPAHLBTDXSSS-UHFFFAOYSA-N
 Ligand Interaction
Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 1.991 Å
  • R-Value Free: 0.242 
  • R-Value Work: 0.213 
  • Space Group: C 2 2 21
Unit Cell:
Length (Å)Angle (°)
a = 33.460α = 90.00
b = 47.680β = 90.00
c = 137.320γ = 90.00
Software Package:
Software NamePurpose
PHASESphasing
SCALAdata scaling
xia2data scaling
xia2data reduction
REFMACrefinement

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History 

Deposition Data

Revision History 

  • Version 1.0: 2013-07-31
    Type: Initial release
  • Version 1.1: 2014-01-08
    Type: Database references