
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 
  • Selection Criteria: structures with the lowest energy 

wwPDB Validation 3D Report Full Report

This is version 1.3 of the entry. See complete history


Encoding canonical DNA quadruplex structure.

Dvorkin, S.A.Karsisiotis, A.I.Webba da Silva, M.

(2018) Sci Adv 4: eaat3007-eaat3007

  • DOI: 10.1126/sciadv.aat3007
  • Primary Citation of Related Structures:  

  • PubMed Abstract: 
  • The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadr ...

    The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications.

    Organizational Affiliation

    School of Pharmacy and Pharmaceutical Sciences, Biomedical Sciences Research Institute, Ulster University, Coleraine BT52 1SA, UK.


Find similar proteins by: Sequence  |  Structure

Entity ID: 1
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 
  • Selection Criteria: structures with the lowest energy 

Structure Validation

View Full Validation Report or Ramachandran Plots

Entry History 

Deposition Data

Revision History 

  • Version 1.0: 2014-07-23
    Type: Initial release
  • Version 1.1: 2014-10-22
    Type: Structure summary
  • Version 1.2: 2018-08-29
    Type: Data collection, Database references
  • Version 1.3: 2018-10-31
    Type: Data collection, Database references