
Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions

Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 
  • Selection Criteria: structures with the lowest energy 

wwPDB Validation 3D Report Full Report

This is version 1.1 of the entry. See complete history


Programming the Self-Assembly of a DNA G-Quadruplex Architecture

Karsisiotis, A.I.Webba da Silva, M.

To be published.


Find similar proteins by: Sequence  |  Structure

Entity ID: 1
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 
  • Selection Criteria: structures with the lowest energy 

Structure Validation

View Full Validation Report or Ramachandran Plots

Entry History 

Deposition Data

Revision History 

  • Version 1.0: 2014-07-23
    Type: Initial release
  • Version 1.1: 2014-10-22
    Type: Structure summary