1TOB

SACCHARIDE-RNA RECOGNITION IN AN AMINOGLYCOSIDE ANTIBIOTIC-RNA APTAMER COMPLEX, NMR, 7 STRUCTURES


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 50 
  • Conformers Submitted: 
  • Selection Criteria: ENERGY (INCLUDING RESTRAINT ENERGY TERM) 

wwPDB Validation   3D Report Full Report


This is version 2.0 of the entry. See complete history


Literature

Saccharide-RNA recognition in an aminoglycoside antibiotic-RNA aptamer complex.

Jiang, L.Suri, A.K.Fiala, R.Patel, D.J.

(1997) Chem Biol 4: 35

  • DOI: 10.1016/s1074-5521(97)90235-0
  • Primary Citation of Related Structures:  
    1TOB

  • PubMed Abstract: 
  • Aminoglycoside antibiotics are known to target ribosomal, retroviral and catalytic RNAs with high affinity and specificity. Recently, in vitro selection experiments have identified RNA aptamers that bind to aminoglycoside antibiotics with nanomolar affinity and stringent specificity, allowing discrimination between closely related family members ...

    Aminoglycoside antibiotics are known to target ribosomal, retroviral and catalytic RNAs with high affinity and specificity. Recently, in vitro selection experiments have identified RNA aptamers that bind to aminoglycoside antibiotics with nanomolar affinity and stringent specificity, allowing discrimination between closely related family members. There has, to date, been limited structural information on the molecular basis of such saccharide-RNA recognition.


    Organizational Affiliation

    Cellular Biochemistry and Biophysics Program, Memorial Sloan-Kettering Cancer Center, new York, NY 10021, USA.



Macromolecules
Find similar nucleic acids by:  (by identity cutoff)  |  3D Structure
Entity ID: 1
MoleculeChainsLengthOrganismImage
RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3')A 27synthetic construct
Protein Feature View
Expand
  • Reference Sequence
Small Molecules
Ligands 3 Unique
IDChainsName / Formula / InChI Key2D Diagram3D Interactions
TOA
Query on TOA

Download Ideal Coordinates CCD File 
B [auth A]3-ammonio-3-deoxy-alpha-D-glucopyranose
C6 H14 N O5
BQCCAEOLPYCBAE-RXRWUWDJSA-O
 Ligand Interaction
TOC
Query on TOC

Download Ideal Coordinates CCD File 
C [auth A]2,6-diammonio-2,3,6-trideoxy-alpha-D-glucopyranose
C6 H16 N2 O3
CEGXIUROHCNLCL-MOJAZDJTSA-P
 Ligand Interaction
TOB
Query on TOB

Download Ideal Coordinates CCD File 
D [auth A]1,3-DIAMINO-5,6-DIHYDROXYCYCLOHEXANE
C6 H16 N2 O2
QOLDZWBHLDQIJR-FSIIMWSLSA-P
 Ligand Interaction
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 50 
  • Conformers Submitted: 
  • Selection Criteria: ENERGY (INCLUDING RESTRAINT ENERGY TERM) 
  • OLDERADO: 1TOB Olderado

Structure Validation

View Full Validation Report




Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 1997-06-16
    Type: Initial release
  • Version 1.1: 2008-03-24
    Changes: Version format compliance
  • Version 1.2: 2011-07-13
    Changes: Version format compliance
  • Version 1.3: 2020-06-24
    Changes: Database references, Derived calculations, Other, Source and taxonomy
  • Version 2.0: 2020-07-29
    Type: Remediation
    Reason: Carbohydrate remediation
    Changes: Atomic model, Data collection, Derived calculations, Structure summary