1TOB

SACCHARIDE-RNA RECOGNITION IN AN AMINOGLYCOSIDE ANTIBIOTIC-RNA APTAMER COMPLEX, NMR, 7 STRUCTURES


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 50 
  • Conformers Submitted: 
  • Selection Criteria: ENERGY (INCLUDING RESTRAINT ENERGY TERM) 

wwPDB Validation 3D Report Full Report


This is version 1.2 of the entry. See complete history

Literature

Saccharide-RNA recognition in an aminoglycoside antibiotic-RNA aptamer complex.

Jiang, L.Suri, A.K.Fiala, R.Patel, D.J.

(1997) Chem.Biol. 4: 35


  • PubMed Abstract: 
  • Aminoglycoside antibiotics are known to target ribosomal, retroviral and catalytic RNAs with high affinity and specificity. Recently, in vitro selection experiments have identified RNA aptamers that bind to aminoglycoside antibiotics with nanomolar a ...

    Aminoglycoside antibiotics are known to target ribosomal, retroviral and catalytic RNAs with high affinity and specificity. Recently, in vitro selection experiments have identified RNA aptamers that bind to aminoglycoside antibiotics with nanomolar affinity and stringent specificity, allowing discrimination between closely related family members. There has, to date, been limited structural information on the molecular basis of such saccharide-RNA recognition.


    Organizational Affiliation

    Cellular Biochemistry and Biophysics Program, Memorial Sloan-Kettering Cancer Center, new York, NY 10021, USA.




Macromolecules

Find similar proteins by: Sequence  |  Structure

Entity ID: 1
MoleculeChainsLengthOrganism
RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3')A27N/A
Small Molecules
Ligands 3 Unique
IDChainsName / Formula / InChI Key2D Diagram3D Interactions
TOB
Query on TOB

Download SDF File 
Download CCD File 
A
1,3-DIAMINO-5,6-DIHYDROXYCYCLOHEXANE
C6 H16 N2 O2
QOLDZWBHLDQIJR-FSIIMWSLSA-P
 Ligand Interaction
TOC
Query on TOC

Download SDF File 
Download CCD File 
A
2,3,6-TRIDEOXY-2,6-DIAMINO GLUCOSE
C6 H16 N2 O3
CEGXIUROHCNLCL-MOJAZDJTSA-P
 Ligand Interaction
TOA
Query on TOA

Download SDF File 
Download CCD File 
A
3-DEOXY-3-AMINO GLUCOSE
C6 H14 N O5
BQCCAEOLPYCBAE-RXRWUWDJSA-O
 Ligand Interaction
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 50 
  • Conformers Submitted: 
  • Selection Criteria: ENERGY (INCLUDING RESTRAINT ENERGY TERM) 
Software Package:
Software NamePurpose
X-PLORrefinement
X-PLORphasing
X-PLORmodel building

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History 

Deposition Data

Revision History 

  • Version 1.0: 1997-06-16
    Type: Initial release
  • Version 1.1: 2008-03-24
    Type: Version format compliance
  • Version 1.2: 2011-07-13
    Type: Version format compliance