1SAX

Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.8 Å
  • R-Value Free: 0.276 
  • R-Value Work: 0.212 

wwPDB Validation 3D Report Full Report


This is version 1.2 of the entry. See complete history

Literature

On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator

Garcia-Castellanos, R.Mallorqui-Fernandez, G.Marrero, A.Potempa, J.Coll, M.Gomis-Ruth, F.X.

(2004) J.Biol.Chem. 279: 17888-17896

  • DOI: 10.1074/jbc.M313123200

  • PubMed Abstract: 
  • Bacterial resistance to antibiotics poses a serious worldwide public health problem due to the high morbidity and mortality caused by infectious diseases. Most hospital-onset infections are associated with methicillin-resistant Staphylococcus aureus ...

    Bacterial resistance to antibiotics poses a serious worldwide public health problem due to the high morbidity and mortality caused by infectious diseases. Most hospital-onset infections are associated with methicillin-resistant Staphylococcus aureus (MRSA) strains that have acquired multiple drug resistance to beta-lactam antibiotics. In a response to antimicrobial stress, nearly all clinical MRSA isolates produce beta-lactamase (BlaZ) and a penicillin-binding protein with low affinity for beta-lactam antibiotics (PBP2a, also known as PBP2' or MecA). Both effectors are regulated by homologous signal transduction systems consisting of a sensor/transducer and a transcriptional repressor. MecI (methicillin repressor) blocks mecA but also blaZ transcription and that of itself and the co-transcribed sensor/transducer. The structure of MecI in complex with a cognate operator double-stranded DNA reveals a homodimeric arrangement with a novel C-terminal spiral staircase dimerization domain responsible for dimer integrity. Each protomer interacts with the DNA major groove through a winged helix DNA-binding domain and specifically recognizes the nucleotide sequence 5'-Gua-Thy-Ade-X-Thy-3'. This results in an unusual convex bending of the DNA helix. The structure of this first molecular determinant of methicillin resistance in complex with its target DNA provides insights into its regulatory mechanism and paves the way for new antimicrobial strategies against MRSA.


    Related Citations: 
    • Three-dimensional structure of MecI. Molecular basis for transcriptional regulation of staphylococcal methicillin resistance
      Garcia-Castellanos, R.,Marrero, A.,Mallorqui-Fernandez, G.,Potempa, J.,Coll, M.,Gomis-Rueth, F.X.
      (2003) J.Biol.Chem. 278: 39897


    Organizational Affiliation

    Institut de Biologia Molecular de Barcelona, CID-CSIC C/Jordi Girona, 18-26, 08034 Barcelona, Spain.




Macromolecules

Find similar proteins by: Sequence  |  Structure


Entity ID: 3
MoleculeChainsSequence LengthOrganismDetails
Methicillin resistance regulatory protein mecI
A, B
123Staphylococcus aureus (strain N315)Mutation(s): 0 
Gene Names: mecI
Find proteins for P68261 (Staphylococcus aureus (strain N315))
Go to UniProtKB:  P68261
Entity ID: 1
MoleculeChainsLengthOrganism
5'-d(GCTCCGATATTACAGTTGTAATTTT)-3'C25N/A
Entity ID: 2
MoleculeChainsLengthOrganism
5'-d(CAAAATTACAACTGTAATATCGGAG)-3'D25N/A
Small Molecules
Ligands 1 Unique
IDChainsName / Formula / InChI Key2D Diagram3D Interactions
K
Query on K

Download SDF File 
Download CCD File 
B
POTASSIUM ION
K
NPYPAHLBTDXSSS-UHFFFAOYSA-N
 Ligand Interaction
Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.8 Å
  • R-Value Free: 0.276 
  • R-Value Work: 0.212 
  • Space Group: P 31 2 1
Unit Cell:
Length (Å)Angle (°)
a = 133.600α = 90.00
b = 133.600β = 90.00
c = 54.700γ = 120.00
Software Package:
Software NamePurpose
XDSdata scaling
REFMACrefinement
XSCALEdata scaling
AMoREphasing
XDSdata reduction

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History 

Deposition Data

Revision History 

  • Version 1.0: 2004-04-27
    Type: Initial release
  • Version 1.1: 2008-04-29
    Type: Version format compliance
  • Version 1.2: 2011-07-13
    Type: Source and taxonomy, Version format compliance