1SAX | pdb_00001sax

Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.80 Å
  • R-Value Free: 
    0.276 (Depositor) 
  • R-Value Work: 
    0.212 (Depositor) 
  • R-Value Observed: 
    0.216 (Depositor) 

Starting Model: experimental
View more details

wwPDB Validation 3D Report Full Report

Validation slider image for 1SAX

This is version 1.3 of the entry. See complete history

Literature

On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator

Garcia-Castellanos, R.Mallorqui-Fernandez, G.Marrero, A.Potempa, J.Coll, M.Gomis-Ruth, F.X.

(2004) J Biol Chem 279: 17888-17896

  • DOI: https://doi.org/10.1074/jbc.M313123200
  • Primary Citation Related Structures: 
    1SAX

  • PubMed Abstract: 

    Bacterial resistance to antibiotics poses a serious worldwide public health problem due to the high morbidity and mortality caused by infectious diseases. Most hospital-onset infections are associated with methicillin-resistant Staphylococcus aureus (MRSA) strains that have acquired multiple drug resistance to beta-lactam antibiotics. In a response to antimicrobial stress, nearly all clinical MRSA isolates produce beta-lactamase (BlaZ) and a penicillin-binding protein with low affinity for beta-lactam antibiotics (PBP2a, also known as PBP2' or MecA). Both effectors are regulated by homologous signal transduction systems consisting of a sensor/transducer and a transcriptional repressor. MecI (methicillin repressor) blocks mecA but also blaZ transcription and that of itself and the co-transcribed sensor/transducer. The structure of MecI in complex with a cognate operator double-stranded DNA reveals a homodimeric arrangement with a novel C-terminal spiral staircase dimerization domain responsible for dimer integrity. Each protomer interacts with the DNA major groove through a winged helix DNA-binding domain and specifically recognizes the nucleotide sequence 5'-Gua-Thy-Ade-X-Thy-3'. This results in an unusual convex bending of the DNA helix. The structure of this first molecular determinant of methicillin resistance in complex with its target DNA provides insights into its regulatory mechanism and paves the way for new antimicrobial strategies against MRSA.


  • Organizational Affiliation
    • Institut de Biologia Molecular de Barcelona, CID-CSIC C/Jordi Girona, 18-26, 08034 Barcelona, Spain.

Macromolecule Content 

  • Total Structure Weight: 45.02 kDa 
  • Atom Count: 3,089 
  • Modeled Residue Count: 290 
  • Deposited Residue Count: 296 
  • Unique protein chains: 1
  • Unique nucleic acid chains: 2

Macromolecules


Find similar proteins by:|  3D Structure
Entity ID: 3
MoleculeChains  Sequence LengthOrganismDetailsImage
Methicillin resistance regulatory protein mecIC [auth A],
D [auth B]
123Staphylococcus aureus subsp. aureus N315Mutation(s): 0 
Gene Names: mecI
UniProt
Find proteins for P68261 (Staphylococcus aureus (strain N315))
Explore P68261 
Go to UniProtKB:  P68261
Entity Groups
Sequence Clusters30% Identity50% Identity70% Identity90% Identity95% Identity100% Identity
UniProt GroupP68261
Sequence Annotations
Expand
Reference Sequence
Find similar nucleic acids by:  Sequence
Entity ID: 1
MoleculeChains LengthOrganismImage
5'-d(GCTCCGATATTACAGTTGTAATTTT)-3'A [auth C]25N/A
Sequence Annotations
Expand
Reference Sequence
Find similar nucleic acids by:  Sequence
Entity ID: 2
MoleculeChains LengthOrganismImage
5'-d(CAAAATTACAACTGTAATATCGGAG)-3'B [auth D]25N/A
Sequence Annotations
Expand
Reference Sequence

Small Molecules

Ligands 1 Unique
IDChains Name / Formula / InChI Key2D Diagram3D Interactions
K

Query on K



Download:Ideal Coordinates CCD File
E [auth B]POTASSIUM ION
K
NPYPAHLBTDXSSS-UHFFFAOYSA-N

Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.80 Å
  • R-Value Free:  0.276 (Depositor) 
  • R-Value Work:  0.212 (Depositor) 
  • R-Value Observed: 0.216 (Depositor) 
Space Group: P 31 2 1
Unit Cell:
Length ( Å )Angle ( ˚ )
a = 133.6α = 90
b = 133.6β = 90
c = 54.7γ = 120
Software Package:
Software NamePurpose
XDSdata scaling
XSCALEdata scaling
AMoREphasing
REFMACrefinement
XDSdata reduction

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 2004-04-27
    Type: Initial release
  • Version 1.1: 2008-04-29
    Changes: Version format compliance
  • Version 1.2: 2011-07-13
    Changes: Source and taxonomy, Version format compliance
  • Version 1.3: 2023-08-23
    Changes: Data collection, Database references, Derived calculations, Refinement description