1R7W

NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 50 
  • Conformers Submitted: 20 
  • Selection Criteria: LOWEST TOTAL ENERGY (A WEIGHTED SUM OF CONFORMATIONAL ENERGY AND RESTRAINT ENERGY) 

wwPDB Validation 3D Report Full Report


This is version 1.2 of the entry. See complete history

Literature

NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).

Du, Z.Ulyanov, N.B.Yu, J.Andino, R.James, T.L.

(2004) Biochemistry 43: 5757-5771

  • DOI: 10.1021/bi0363228
  • Primary Citation of Related Structures:  1R7Z

  • PubMed Abstract: 
  • The 5'-untranslated region of positive-strand RNA viruses harbors many cis-acting RNA structural elements that are important for various viral processes such as replication, translation, and packaging of new virions. Among these is loop B RNA of the ...

    The 5'-untranslated region of positive-strand RNA viruses harbors many cis-acting RNA structural elements that are important for various viral processes such as replication, translation, and packaging of new virions. Among these is loop B RNA of the stem-loop IV domain within the internal ribosomal entry site (IRES) of enteroviruses, including Poliovirus type 1 (PV1). Studies on PV1 have shown that specific recognition of loop B by the first KH (hnRNP K homology) domain of cellular poly(rC)-binding protein 2 (PCBP2) is essential for efficient translation of the viral mRNA. Here we report the NMR solution structures of two representative sequence variants of enteroviral loop B RNA. The two RNA variants differ at only one position (C vs U) within a six-nucleotide asymmetric internal loop sequence that is the binding site for the PCBP2 KH1 domain. Surprisingly, the two RNAs are drastically different in the overall shape and local dynamics of the bulge region. The RNA with the 5'-AUCCCU bulge sequence adopts an overall L shape. Its bulge nucleotides, especially the last four, are highly flexible and not very well defined by NMR. The RNA with the 5'-AUUCCU bulge sequence adopts an overall U shape, and its bulge sequence exhibits only limited flexibility. A detailed analysis of the two RNA structures and their dynamic properties, as well as available sequence data and known KH domain-RNA complex structures, not only provides insights into how loop B RNA might be recognized by the PCBP2 KH1 domain but also suggests a possible correlation between structural flexibility and pre-existing structural features for protein recognition.


    Organizational Affiliation

    Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94143-2280, USA.




Macromolecules

Find similar proteins by: Sequence  |  Structure

Entity ID: 1
MoleculeChainsLengthOrganism
34-MERA34N/A
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 50 
  • Conformers Submitted: 20 
  • Selection Criteria: LOWEST TOTAL ENERGY (A WEIGHTED SUM OF CONFORMATIONAL ENERGY AND RESTRAINT ENERGY) 

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History 

Deposition Data

Revision History 

  • Version 1.0: 2004-05-25
    Type: Initial release
  • Version 1.1: 2008-04-29
    Type: Version format compliance
  • Version 1.2: 2011-07-13
    Type: Version format compliance