1FG0

LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 3 Å

wwPDB Validation 3D Report Full Report


This is version 1.2 of the entry. See complete history

Literature

The structural basis of ribosome activity in peptide bond synthesis.

Nissen, P.Hansen, J.Ban, N.Moore, P.B.Steitz, T.A.

(2000) Science 289: 920-930

  • Primary Citation of Related Structures:  1FFZ

  • PubMed Abstract: 
  • Using the atomic structures of the large ribosomal subunit from Haloarcula marismortui and its complexes with two substrate analogs, we establish that the ribosome is a ribozyme and address the catalytic properties of its all-RNA active site. Both su ...

    Using the atomic structures of the large ribosomal subunit from Haloarcula marismortui and its complexes with two substrate analogs, we establish that the ribosome is a ribozyme and address the catalytic properties of its all-RNA active site. Both substrate analogs are contacted exclusively by conserved ribosomal RNA (rRNA) residues from domain V of 23S rRNA; there are no protein side-chain atoms closer than about 18 angstroms to the peptide bond being synthesized. The mechanism of peptide bond synthesis appears to resemble the reverse of the acylation step in serine proteases, with the base of A2486 (A2451 in Escherichia coli) playing the same general base role as histidine-57 in chymotrypsin. The unusual pK(a) (where K(a) is the acid dissociation constant) required for A2486 to perform this function may derive in part from its hydrogen bonding to G2482 (G2447 in E. coli), which also interacts with a buried phosphate that could stabilize unusual tautomers of these two bases. The polypeptide exit tunnel is largely formed by RNA but has significant contributions from proteins L4, L22, and L39e, and its exit is encircled by proteins L19, L22, L23, L24, L29, and L31e.


    Related Citations: 
    • Placement of protein and RNA structures into a 5 A-resolution map of the 50S ribosomal subunit
      Ban, N.,Nissen, P.,Hansen, J.,Capel, M.,Moore, P.B.,Steitz, T.A.
      (1999) Nature 400: 841
    • The complete atomic structure of the large ribosomal subunit at 2.4 A resolution
      Ban, N,Nissen, P.,Hansen, J.,Moore, P.B.,Steitz, T.A.
      (2000) Science 289: 905


    Organizational Affiliation

    Department of Molecular Biophysics and Biochemistry and Department of Chemistry, Yale University, and Howard Hughes Medical Institute, New Haven, CT 06520-8114, USA.




Macromolecules

Find similar proteins by: Sequence  |  Structure

Entity ID: 1
MoleculeChainsLengthOrganism
23S RIBOSOMAL RNAA602Haloarcula marismortui
Entity ID: 2
MoleculeChainsLengthOrganism
5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3'B34N/A
Small Molecules
Modified Residues  1 Unique
IDChainsTypeFormula2D DiagramParent
PPU
Query on PPU
B
RNA LINKINGC22 H30 N7 O8 PA
Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 3 Å
  • Space Group: C 2 2 21
Unit Cell:
Length (Å)Angle (°)
a = 212.000α = 90.00
b = 300.000β = 90.00
c = 574.000γ = 90.00
Software Package:
Software NamePurpose
CNSrefinement
CNSphasing
DENZOdata reduction
Omodel building
SCALEPACKdata scaling

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History 

Deposition Data

Revision History 

  • Version 1.0: 2000-08-28
    Type: Initial release
  • Version 1.1: 2008-04-27
    Type: Version format compliance
  • Version 1.2: 2011-07-13
    Type: Version format compliance