5J05

DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium

SOLUTION NMR

NMR Experiment
Experiment	Type	Sample Contents	Solvent	Ionic Strength	pH	Pressure	Temperature (K)	Spectrometer
1	H,H jr-NOESY	1 mM DNA	93% H2O/7% D2O	20 mM NaPi mM	6.8	1 atm	293.15	Varian VNMRS 500
2	2D 1H-1H NOESY	1 mM DNA	100% D2O	20 mM NaPi mM	6.8	1 atm	293.15	Varian VNMRS 500

NMR Spectrometer Information
Spectrometer	Manufacturer	Model	Field Strength
1	Varian	VNMRS	500

NMR Refinement
Method	Details	Software
molecular dynamics		Xplor-NIH

NMR Ensemble Information
Conformer Selection Criteria	structures with the lowest energy
Conformers Calculated Total Number	100
Conformers Submitted Total Number	10
Representative Model	1 (lowest energy)

Computation: NMR Software
#	Classification	Version	Software Name	Author
1	refinement	Felix		Accelrys Software Inc.
2	structure calculation	Xplor-NIH		Schwieters, Kuszewski, Tjandra and Clore
3	chemical shift assignment	Felix		Accelrys Software Inc.

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM133198.