☰ Navigation Tabs
Crystal structure of Fis bound to 27bp DNA F1-8G (AAATTGGTTTGAATTTTGAGCCAATTT)
Crystallization Crystalization Experiments ID Method pH Temperature Details 1 VAPOR DIFFUSION, HANGING DROP 8.5 277 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400
Crystal Properties Matthews coefficient Solvent content 4 69.28
Crystal Data Unit Cell Length ( Å ) Angle ( ˚ ) a = 43.35 α = 90 b = 93.37 β = 90 c = 154.68 γ = 90
Symmetry Space Group P 21 21 21
Diffraction Diffraction Experiment ID # Crystal ID Scattering Type Data Collection Temperature Detector Detector Type Details Collection Date Monochromator Protocol 1 1 x-ray 100 CCD ADSC QUANTUM 315 2010-10-17 M SINGLE WAVELENGTH
Radiation Source ID # Source Type Wavelength List Synchrotron Site Beamline 1 SYNCHROTRON APS BEAMLINE 24-ID-C 0.97949 APS 24-ID-C
Data Collection Overall ID # Resolution (High) Resolution (Low) Percent Possible (Observed) R Merge I (Observed) Rpim I (All) CC (Half) Net I Over Average Sigma (I) Redundancy Number Reflections (All) Number Reflections (Observed) Observed Criterion Sigma (F) Observed Criterion Sigma (I) B (Isotropic) From Wilson Plot 1 2.66 154.68 93.7 0.083 0.04 0.997 11.3 4.8 17612 36.79
Highest Resolution Shell ID # Resolution (High) Resolution (Low) Percent Possible (All) Percent Possible (Observed) R Merge I (Observed) Rpim I (All) CC (Half) Mean I Over Sigma (Observed) Redundancy Number Unique Reflections (All) 1 2.66 2.8 97.2 0.67 0.312 0.903 2.4 5 2586
Refinement Statistics Diffraction ID Structure Solution Method Cross Validation method Resolution (High) Resolution (Low) Cut-off Sigma (F) Number Reflections (Observed) Number Reflections (R-Free) Percent Reflections (Observed) R-Factor (Observed) R-Work (Depositor) R-Work (DCC) R-Free (Depositor) R-Free (DCC) Mean Isotropic B X-RAY DIFFRACTION MOLECULAR REPLACEMENT FREE R-VALUE 2.66 59.561 1.33 17270 1729 91.61 0.214 0.2099 0.2253 0.249 0.252 54.6968
Temperature Factor Modeling Anisotropic B[1][1] Anisotropic B[1][2] Anisotropic B[1][3] Anisotropic B[2][2] Anisotropic B[2][3] Anisotropic B[3][3]
RMS Deviations Key Refinement Restraint Deviation f_dihedral_angle_d 24.851 f_angle_d 0.954 f_chiral_restr 0.036 f_bond_d 0.005 f_plane_restr 0.004
Non-Hydrogen Atoms Used in Refinement Non-Hydrogen Atoms Number Protein Atoms 1505 Nucleic Acid Atoms 1101 Solvent Atoms 4 Heterogen Atoms
Software Software Software Name Purpose Aimless data scaling PHASER phasing PHENIX refinement PDB_EXTRACT data extraction XDS data reduction