Crystal Structure of the P22 c2 Repressor protein in complex with the synthetic operator 9T
X-RAY DIFFRACTION
Crystallization
| Crystalization Experiments | ||||
|---|---|---|---|---|
| ID | Method | pH | Temperature | Details |
| 1 | VAPOR DIFFUSION, HANGING DROP | 7.8 | 277 | The initial crystallization solution contained 0.42 mM P22R NTD, 0.42 mM duplex d(5 TATTTAAGATATCTTAAATG3 ) -d(5 CATTTAAGATATCTTAAATA3 ), 45 mM Tris.HCl (pH 7.8), 19 mM NaCl, 1.9 mM glycerol, 11% PEG 400, 4.5 mM LiCl, 2.3mM MgCl2 and 0.91% MPD in a volume of 5.3 ul. The crystallization solution was equilibrated against a reservoir of 100 mM Tris.HCl (pH 7.8), 25% PEG 400, 10 mM LiCl, 5 mM MgCl2 and 2% MPD, VAPOR DIFFUSION, HANGING DROP, temperature 277K |
| Crystal Properties | |
|---|---|
| Matthews coefficient | Solvent content |
| 3.8 | 67.61 |
Crystal Data
| Unit Cell | |
|---|---|
| Length ( Å ) | Angle ( ˚ ) |
| a = 64.105 | α = 90 |
| b = 64.105 | β = 90 |
| c = 101.685 | γ = 90 |
| Symmetry | |
|---|---|
| Space Group | P 43 |
Diffraction
| Diffraction Experiment | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ID # | Crystal ID | Scattering Type | Data Collection Temperature | Detector | Detector Type | Details | Collection Date | Monochromator | Protocol | |||||
| 1 | 1 | x-ray | 100 | CCD | MARMOSAIC 300 mm CCD | M | SINGLE WAVELENGTH | |||||||
| Radiation Source | |||||
|---|---|---|---|---|---|
| ID # | Source | Type | Wavelength List | Synchrotron Site | Beamline |
| 1 | SYNCHROTRON | APS BEAMLINE 22-ID | 1 | APS | 22-ID |
Data Collection
| Overall | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ID # | Resolution (High) | Resolution (Low) | Percent Possible (Observed) | R Sym I (Observed) | Net I Over Average Sigma (I) | Redundancy | Number Reflections (All) | Number Reflections (Observed) | Observed Criterion Sigma (F) | Observed Criterion Sigma (I) | B (Isotropic) From Wilson Plot | ||||||||
| 1 | 1.53 | 35 | 99.4 | 0.069 | 47.1 | 5.8 | 60878 | 60878 | |||||||||||
| Highest Resolution Shell | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ID # | Resolution (High) | Resolution (Low) | Percent Possible (All) | Percent Possible (Observed) | R Merge I (Observed) | R-Sym I (Observed) | Mean I Over Sigma (Observed) | Redundancy | Number Unique Reflections (All) | ||||||||||
| 1.53 | 1.57 | 99.3 | 0.659 | 0.659 | 2.12 | 4.7 | 4319 | ||||||||||||
Refinement
| Statistics | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Diffraction ID | Structure Solution Method | Resolution (High) | Resolution (Low) | Number Reflections (Observed) | Number Reflections (R-Free) | Percent Reflections (Observed) | R-Work (Depositor) | R-Work (DCC) | R-Free (Depositor) | R-Free (DCC) | Mean Isotropic B | ||||||||
| X-RAY DIFFRACTION | MOLECULAR REPLACEMENT | 1.53 | 35 | 59833 | 6068 | 96.9 | 0.204 | 0.2 | 0.225 | 0.23 | 31.053 | ||||||||
| Temperature Factor Modeling | ||||||
|---|---|---|---|---|---|---|
| Anisotropic B[1][1] | Anisotropic B[1][2] | Anisotropic B[1][3] | Anisotropic B[2][2] | Anisotropic B[2][3] | Anisotropic B[3][3] | |
| RMS Deviations | |
|---|---|
| Key | Refinement Restraint Deviation |
| c_scangle_it | 3.05 |
| c_mcangle_it | 2.006 |
| c_scbond_it | 1.983 |
| c_angle_deg | 1.334 |
| c_mcbond_it | 1.278 |
| c_bond_d | 0.01 |
| Non-Hydrogen Atoms Used in Refinement | |
|---|---|
| Non-Hydrogen Atoms | Number |
| Protein Atoms | 1030 |
| Nucleic Acid Atoms | 814 |
| Solvent Atoms | 331 |
| Heterogen Atoms | |
Software
| Software | |
|---|---|
| Software Name | Purpose |
| DENZO | data reduction |
| SCALEPACK | data scaling |
| CNS | refinement |
| PDB_EXTRACT | data extraction |
| HKL-2000 | data collection |
| CNS | phasing |














