5DTD | pdb_00005dtd

Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)


Domain Annotation: SCOP2 Classification SCOP2 Database Homepage

ChainsTypeFamily Name Domain Identifier Family IdentifierProvenance Source (Version)
BSCOP2B SuperfamilyHomeodomain-like 8002272 3000001 SCOP2B (2022-06-29)
ASCOP2B SuperfamilyHomeodomain-like 8002272 3000001 SCOP2B (2022-06-29)

Domain Annotation: ECOD Classification ECOD Database Homepage

ChainsFamily NameDomain Identifier ArchitecturePossible HomologyHomologyTopologyFamilyProvenance Source (Version)
BComo_SCPe5dtdB1 A: a/b three-layered sandwichesX: HTHH: Baseplate wedge protein gp6 helical domainT: Baseplate wedge protein gp6 helical domainF: Como_SCPECOD (v294.1)
AComo_SCPe5dtdA1 A: a/b three-layered sandwichesX: HTHH: Baseplate wedge protein gp6 helical domainT: Baseplate wedge protein gp6 helical domainF: Como_SCPECOD (v294.1)

Domain Annotation: CATH CATH Database Homepage

ChainDomainClassArchitectureTopologyHomologyProvenance Source (Version)
B1.10.10.60 Mainly Alpha Orthogonal Bundle Arc Repressor Mutant, subunit A Homeodomain-likeCATH (4.3.0)
A1.10.10.60 Mainly Alpha Orthogonal Bundle Arc Repressor Mutant, subunit A Homeodomain-likeCATH (4.3.0)

Protein Family Annotation Pfam Database Homepage

ChainsAccessionNameDescriptionCommentsSource
A, B
PF02954Bacterial regulatory protein, Fis family (HTH_8)Bacterial regulatory protein, Fis familyDomain

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

ChainsPolymerMolecular FunctionBiological ProcessCellular Component
DNA (27-MER)---
DNA (27-MER)---
A, B
DNA-binding protein Fis

InterPro: Protein Family Classification InterPro Database Homepage