4P0S | pdb_00004p0s

human Mus81-Eme1-3'flap DNA complex

External Resource: Annotation

Domain Annotation: ECOD Classification
Protein Family Annotation
Gene Ontology: Gene Product Annotation
InterPro: Protein Family Classification
Pharos: Disease Associations

Domain Annotation: ECOD Classification ECOD Database Homepage

Chains	Family Name	Domain Identifier	Architecture	Possible Homology	Homology	Topology	Family	Provenance Source (Version)
H	Spermine_synth	e4p0sH1	A: a/b three-layered sandwiches	X: HTH	H: Toll/Interleukin receptor TIR domain	T: Toll/Interleukin receptor TIR domain	F: Spermine_synth	ECOD (v294.1)
F	Spermine_synth	e4p0sF1	A: a/b three-layered sandwiches	X: HTH	H: Toll/Interleukin receptor TIR domain	T: Toll/Interleukin receptor TIR domain	F: Spermine_synth	ECOD (v294.1)
D	Spermine_synth	e4p0sD1	A: a/b three-layered sandwiches	X: HTH	H: Toll/Interleukin receptor TIR domain	T: Toll/Interleukin receptor TIR domain	F: Spermine_synth	ECOD (v294.1)
B	Spermine_synth	e4p0sB1	A: a/b three-layered sandwiches	X: HTH	H: Toll/Interleukin receptor TIR domain	T: Toll/Interleukin receptor TIR domain	F: Spermine_synth	ECOD (v294.1)
G	Spermine_synth	e4p0sG1	A: a/b three-layered sandwiches	X: HTH	H: Toll/Interleukin receptor TIR domain	T: Toll/Interleukin receptor TIR domain	F: Spermine_synth	ECOD (v294.1)
E	Spermine_synth	e4p0sE1	A: a/b three-layered sandwiches	X: HTH	H: Toll/Interleukin receptor TIR domain	T: Toll/Interleukin receptor TIR domain	F: Spermine_synth	ECOD (v294.1)
C	Spermine_synth	e4p0sC1	A: a/b three-layered sandwiches	X: HTH	H: Toll/Interleukin receptor TIR domain	T: Toll/Interleukin receptor TIR domain	F: Spermine_synth	ECOD (v294.1)
A	Spermine_synth	e4p0sA1	A: a/b three-layered sandwiches	X: HTH	H: Toll/Interleukin receptor TIR domain	T: Toll/Interleukin receptor TIR domain	F: Spermine_synth	ECOD (v294.1)

Protein Family Annotation Pfam Database Homepage

Chains	Accession	Name	Description	Comments	Source
B, D, F, H	PF21292	EME1/MUS81, C-terminal (EME1-MUS81_C)	EME1/MUS81, C-terminal	EME1 and MUS81 form a complex that acts as a structure-specific endonuclease, playing an important role in rescuing stalled replication forks and resolving the meiotic recombination intermediates in eukaryotes [1,2]. Both consist of a central nucleas ...	EME1 and MUS81 form a complex that acts as a structure-specific endonuclease, playing an important role in rescuing stalled replication forks and resolving the meiotic recombination intermediates in eukaryotes [1,2]. Both consist of a central nuclease domain (Pfam:PF02732), two repeats of the helix-hairpin-helix (HhH) motif and a linker helix. This entry represents the C-terminal HhH domain of EME1 and MUS81 [1,2]. Similar to EME1-MUS81, human MUS81-EME2 cleaves 3'-flaps, replication forks and nicked Holliday junctions, and exhibits limited endonuclease activity with intact Holliday junctions.	Domain
B, D, F, H	PF02732	ERCC4 domain (ERCC4)	ERCC4 domain	This domain is a family of nucleases. The family includes EME1 which is an essential component of a Holliday junction resolvase [2-3]. EME1 interacts with MUS81 to form a DNA structure-specific endonuclease.	Domain
A, C, E, G	PF21292	EME1/MUS81, C-terminal (EME1-MUS81_C)	EME1/MUS81, C-terminal	EME1 and MUS81 form a complex that acts as a structure-specific endonuclease, playing an important role in rescuing stalled replication forks and resolving the meiotic recombination intermediates in eukaryotes [1,2]. Both consist of a central nucleas ...	EME1 and MUS81 form a complex that acts as a structure-specific endonuclease, playing an important role in rescuing stalled replication forks and resolving the meiotic recombination intermediates in eukaryotes [1,2]. Both consist of a central nuclease domain (Pfam:PF02732), two repeats of the helix-hairpin-helix (HhH) motif and a linker helix. This entry represents the C-terminal HhH domain of EME1 and MUS81 [1,2]. Similar to EME1-MUS81, human MUS81-EME2 cleaves 3'-flaps, replication forks and nicked Holliday junctions, and exhibits limited endonuclease activity with intact Holliday junctions.	Domain
A, C, E, G	PF02732	ERCC4 domain (ERCC4)	ERCC4 domain	This domain is a family of nucleases. The family includes EME1 which is an essential component of a Holliday junction resolvase [2-3]. EME1 interacts with MUS81 to form a DNA structure-specific endonuclease.	Domain

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

Chains	Polymer	Molecular Function	Biological Process	Cellular Component
K [auth L], N [auth P], Q [auth T], T [auth X]	DNA TCTGCATGTCATT	-	-	-
J, M [auth N], P [auth R], S [auth V]	DNA TAGACACACATTCGGGACATGCAG	-	-	-
I, L [auth M], O [auth Q], R [auth U]	DNA GAATGTGTGTCT	-	-	-
B, D, F, H	Crossover junction endonuclease EME1	DNA binding binding nucleic acid binding nuclease activity catalytic activity, acting on a nucleic acid catalytic activity cation binding ion binding metal ion binding small molecule binding	DNA-templated DNA replication DNA-templated DNA replication maintenance of fidelity primary metabolic process DNA metabolic process nucleic acid metabolic process nucleobase-containing compound metabolic process DNA replication metabolic process cellular process macromolecule metabolic process replication fork processing DNA recombination mitotic recombination resolution of mitotic recombination intermediates DNA-templated DNA replication DNA-templated DNA replication maintenance of fidelity primary metabolic process DNA metabolic process nucleic acid metabolic process nucleobase-containing compound metabolic process DNA replication metabolic process cellular process macromolecule metabolic process replication fork processing DNA recombination mitotic recombination resolution of mitotic recombination intermediates resolution of DNA recombination intermediates sexual reproduction homologous recombination reproductive process resolution of meiotic recombination intermediates meiotic cell cycle process cellular component organization meiosis I meiotic nuclear division cell cycle cellular component organization or biogenesis reciprocal homologous recombination cell cycle process meiotic cell cycle organelle fission reciprocal meiotic recombination nuclear division organelle organization meiosis I cell cycle process cellular response to stimulus double-strand break repair response to stimulus cellular response to stress DNA damage response response to stress DNA repair DNA damage checkpoint signaling regulation of cellular process regulation of cell cycle phase transition signaling negative regulation of biological process negative regulation of cell cycle cell cycle phase transition intracellular signal transduction mitotic cell cycle negative regulation of mitotic cell cycle cell communication regulation of mitotic cell cycle mitotic DNA integrity checkpoint signaling mitotic DNA damage checkpoint signaling negative regulation of cellular process negative regulation of cell cycle phase transition signal transduction mitotic intra-S DNA damage checkpoint signaling regulation of cell cycle regulation of biological process regulation of cell cycle process biological regulation DNA integrity checkpoint signaling negative regulation of cell cycle process cell cycle checkpoint signaling mitotic cell cycle checkpoint signaling mitotic cell cycle process signal transduction in response to DNA damage response to endogenous stimulus response to intra-S DNA damage checkpoint signaling response to biotic stimulus cellular response to biotic stimulus cellular response to endogenous stimulus response to DNA integrity checkpoint signaling response to DNA damage checkpoint signaling response to cell cycle checkpoint signaling	membrane-bounded organelle intracellular anatomical structure nucleus membrane-enclosed lumen intracellular membraneless organelle intracellular membrane-bounded organelle nucleolus intracellular organelle lumen intracellular organelle cellular anatomical structure organelle lumen organelle membraneless organelle nuclear lumen membrane-bounded organelle intracellular anatomical structure nucleus membrane-enclosed lumen intracellular membraneless organelle intracellular membrane-bounded organelle nucleolus intracellular organelle lumen intracellular organelle cellular anatomical structure organelle lumen organelle membraneless organelle nuclear lumen nuclear chromosome chromosome chromatin heterochromatin protein-containing complex catalytic complex endodeoxyribonuclease complex Holliday junction resolvase complex intracellular protein-containing complex endonuclease complex nuclear replication fork replication fork nucleoplasm
A, C, E, G	Crossover junction endonuclease MUS81	DNA endonuclease activity endonuclease activity catalytic activity, acting on DNA nuclease activity catalytic activity, acting on a nucleic acid catalytic activity DNA nuclease activity hydrolase activity 3'-flap endonuclease activity DNA endonuclease activity, producing 3'-phosphomonoesters hydrolase activity, acting on ester bonds flap endonuclease activity DNA binding binding DNA endonuclease activity endonuclease activity catalytic activity, acting on DNA nuclease activity catalytic activity, acting on a nucleic acid catalytic activity DNA nuclease activity hydrolase activity 3'-flap endonuclease activity DNA endonuclease activity, producing 3'-phosphomonoesters hydrolase activity, acting on ester bonds flap endonuclease activity DNA binding binding nucleic acid binding crossover junction DNA endonuclease activity cation binding ion binding metal ion binding small molecule binding	catabolic process primary metabolic process DNA metabolic process nucleic acid metabolic process macromolecule catabolic process nucleobase-containing compound catabolic process nucleobase-containing compound metabolic process DNA catabolic process nucleic acid catabolic process metabolic process cellular process macromolecule metabolic process DNA-templated DNA replication DNA-templated DNA replication maintenance of fidelity catabolic process primary metabolic process DNA metabolic process nucleic acid metabolic process macromolecule catabolic process nucleobase-containing compound catabolic process nucleobase-containing compound metabolic process DNA catabolic process nucleic acid catabolic process metabolic process cellular process macromolecule metabolic process DNA-templated DNA replication DNA-templated DNA replication maintenance of fidelity DNA replication replication fork processing DNA recombination mitotic recombination resolution of mitotic recombination intermediates resolution of DNA recombination intermediates cell population proliferation osteoblast proliferation sexual reproduction homologous recombination reproductive process resolution of meiotic recombination intermediates meiotic cell cycle process cellular component organization meiosis I meiotic nuclear division cell cycle cellular component organization or biogenesis reciprocal homologous recombination cell cycle process meiotic cell cycle organelle fission reciprocal meiotic recombination nuclear division organelle organization meiosis I cell cycle process cellular response to stimulus double-strand break repair response to stimulus double-strand break repair via break-induced replication cellular response to stress DNA damage response response to stress recombinational repair double-strand break repair via homologous recombination DNA repair telomere organization chromosome organization telomere maintenance DNA damage checkpoint signaling regulation of cellular process regulation of cell cycle phase transition signaling negative regulation of biological process negative regulation of cell cycle cell cycle phase transition intracellular signal transduction mitotic cell cycle negative regulation of mitotic cell cycle cell communication regulation of mitotic cell cycle mitotic DNA integrity checkpoint signaling mitotic DNA damage checkpoint signaling negative regulation of cellular process negative regulation of cell cycle phase transition signal transduction mitotic intra-S DNA damage checkpoint signaling regulation of cell cycle regulation of biological process regulation of cell cycle process biological regulation DNA integrity checkpoint signaling negative regulation of cell cycle process cell cycle checkpoint signaling mitotic cell cycle checkpoint signaling mitotic cell cycle process signal transduction in response to DNA damage response to endogenous stimulus response to intra-S DNA damage checkpoint signaling response to biotic stimulus cellular response to biotic stimulus cellular response to endogenous stimulus response to DNA integrity checkpoint signaling response to DNA damage checkpoint signaling response to cell cycle checkpoint signaling	membrane-bounded organelle intracellular anatomical structure nucleus membrane-enclosed lumen intracellular membraneless organelle intracellular membrane-bounded organelle nucleolus intracellular organelle lumen intracellular organelle cellular anatomical structure organelle lumen organelle membraneless organelle nuclear lumen membrane-bounded organelle intracellular anatomical structure nucleus membrane-enclosed lumen intracellular membraneless organelle intracellular membrane-bounded organelle nucleolus intracellular organelle lumen intracellular organelle cellular anatomical structure organelle lumen organelle membraneless organelle nuclear lumen protein-containing complex catalytic complex endodeoxyribonuclease complex Holliday junction resolvase complex intracellular protein-containing complex endonuclease complex nucleoplasm replication fork chromosome nuclear replication fork nuclear chromosome chromosome, telomeric region chromosomal region

InterPro: Protein Family Classification InterPro Database Homepage

Chains	Accession	Name	Type
B, D, F, H	IPR043087	EME1, nuclease domain, subdomain 2	Homologous Superfamily
B, D, F, H	IPR042530	EME1/EME2, C-terminal domain	Homologous Superfamily
B, D, F, H	IPR047522	Crossover junction endonuclease EME1, XPF-like nuclease domain, vertebrates	Domain
B, D, F, H	IPR033310	Mms4/EME1/EME2	Family
B, D, F, H	IPR043086	EME1, nuclease domain, subdomain 1	Homologous Superfamily
B, D, F, H	IPR006166	ERCC4 domain	Domain
A, C, E, G	IPR011335	Restriction endonuclease type II-like	Homologous Superfamily
A, C, E, G	IPR047417	MUS81, winged helix domain	Domain
A, C, E, G	IPR010996	Crossover junction endonuclease MUS81-like, HHH domain	Domain
A, C, E, G	IPR027421	DNA polymerase lambda lyase domain superfamily	Homologous Superfamily
A, C, E, G	IPR006166	ERCC4 domain	Domain
A, C, E, G	IPR047416	MUS81, XPF-like nuclease domain	Domain
A, C, E, G	IPR042530	EME1/EME2, C-terminal domain	Homologous Superfamily
A, C, E, G	IPR033309	Crossover junction endonuclease Mus81	Family
A, C, E, G	IPR036388	Winged helix-like DNA-binding domain superfamily	Homologous Superfamily

Pharos: Disease Associations Pharos Homepage Annotation

Chains	Drug Target	Associated Disease
B, D, F, H	Pharos: Q96AY2	astrocytic tumor chronic obstructive pulmonary disease exocrine pancreatic carcinoma invasive ductal breast carcinoma malignant pancreatic neoplasm ovarian cancer atypical teratoid rhabdoid tumor Crohn disease glioblastoma large cell medulloblastoma medulloblastoma breast cancer ductal breast carcinoma in situ interstitial cystitis lung adenocarcinoma astrocytic tumor chronic obstructive pulmonary disease exocrine pancreatic carcinoma invasive ductal breast carcinoma malignant pancreatic neoplasm ovarian cancer atypical teratoid rhabdoid tumor Crohn disease glioblastoma large cell medulloblastoma medulloblastoma breast cancer ductal breast carcinoma in situ interstitial cystitis lung adenocarcinoma osteosarcoma
A, C, E, G	Pharos: Q96NY9	allergic rhinitis Crohn disease ovarian cancer systemic lupus erythematosus atopic eczema inflammatory bowel disease psoriasis breast carcinoma osteosarcoma skin basal cell carcinoma

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM157729. RCSB PDB uses resources of the National Energy Research Scientific Computing Center (NERSC), a Department of Energy User Facility.