Domain Annotation: SCOP2 Classification SCOP2 Database Homepage

ChainsTypeFamily Name Domain Identifier Family IdentifierProvenance Source (Version)
C [auth A]SCOP2B SuperfamilyCore histone-like8041272 3001387 SCOP2B (2022-06-29)
G [auth E]SCOP2B SuperfamilyCore histone-like8041272 3001387 SCOP2B (2022-06-29)
D [auth B]SCOP2B SuperfamilyCore histone-like8042439 3001387 SCOP2B (2022-06-29)
H [auth F]SCOP2B SuperfamilyCore histone-like8042439 3001387 SCOP2B (2022-06-29)
E [auth C]SCOP2B SuperfamilyCore histone-like8041278 3001387 SCOP2B (2022-06-29)
I [auth G]SCOP2B SuperfamilyCore histone-like8041278 3001387 SCOP2B (2022-06-29)
F [auth D]SCOP2B SuperfamilyCore histone-like8041279 3001387 SCOP2B (2022-06-29)
J [auth H]SCOP2B SuperfamilyCore histone-like8041279 3001387 SCOP2B (2022-06-29)

Domain Annotation: ECOD Classification ECOD Database Homepage

ChainsFamily NameDomain Identifier ArchitecturePossible HomologyHomologyTopologyFamilyProvenance Source (Version)
C [auth A]Histonee1kx3A1 A: alpha arraysX: Histone-likeH: Histone-relatedT: HistoneF: HistoneECOD (1.6)
G [auth E]Histonee1kx3E1 A: alpha arraysX: Histone-likeH: Histone-relatedT: HistoneF: HistoneECOD (1.6)
D [auth B]Histone_1e1kx3B1 A: alpha arraysX: Histone-likeH: Histone-relatedT: HistoneF: Histone_1ECOD (1.6)
H [auth F]Histone_1e1kx3F1 A: alpha arraysX: Histone-likeH: Histone-relatedT: HistoneF: Histone_1ECOD (1.6)
E [auth C]Histone_1e1kx3C1 A: alpha arraysX: Histone-likeH: Histone-relatedT: HistoneF: Histone_1ECOD (1.6)
I [auth G]Histone_1e1kx3G1 A: alpha arraysX: Histone-likeH: Histone-relatedT: HistoneF: Histone_1ECOD (1.6)
F [auth D]Histonee1kx3D1 A: alpha arraysX: Histone-likeH: Histone-relatedT: HistoneF: HistoneECOD (1.6)
J [auth H]Histonee1kx3H1 A: alpha arraysX: Histone-likeH: Histone-relatedT: HistoneF: HistoneECOD (1.6)

Domain Annotation: CATH CATH Database Homepage

Protein Family Annotation Pfam Database Homepage

ChainsAccessionNameDescriptionCommentsSource
C [auth A],
G [auth E]
PF00125Core histone H2A/H2B/H3/H4 (Histone)Core histone H2A/H2B/H3/H4- Domain
D [auth B],
H [auth F]
PF15511Centromere kinetochore component CENP-T histone fold (CENP-T_C)Centromere kinetochore component CENP-T histone foldCENP-T is a family of vertebral kinetochore proteins that associates directly with CENP-W. The N-terminus of CENP-T proteins interacts directly with the Ndc80 complex in the outer kinetochore. Importantly, the CENP-T-W complex does not directly asso ...CENP-T is a family of vertebral kinetochore proteins that associates directly with CENP-W. The N-terminus of CENP-T proteins interacts directly with the Ndc80 complex in the outer kinetochore. Importantly, the CENP-T-W complex does not directly associate with CENP-A, but with histone H3 in the centromere region. CENP-T and -W form a hetero-tetramer with CENP-S and -X and bind to a ~100 bp region of nucleosome-free DNA forming a nucleosome-like structure. The DNA-CENP-T-W-S-X complex is likely to be associated with histone H3-containing nucleosomes rather than with CENP-nucleosomes. This domain is the C-terminal histone fold domain of CENP-T, which associates with chromatin [2-3].
Domain
E [auth C],
I [auth G]
PF16211C-terminus of histone H2A (Histone_H2A_C)C-terminus of histone H2A- Family
E [auth C],
I [auth G]
PF00125Core histone H2A/H2B/H3/H4 (Histone)Core histone H2A/H2B/H3/H4- Domain
F [auth D],
J [auth H]
PF00125Core histone H2A/H2B/H3/H4 (Histone)Core histone H2A/H2B/H3/H4- Domain

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

ChainsPolymerMolecular FunctionBiological ProcessCellular Component
A [auth I],
B [auth J]
DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3')---
C [auth A],
G [auth E]
histone H3 -
D [auth B],
H [auth F]
histone H4 -
E [auth C],
I [auth G]
histone H2A.1 -
F [auth D],
J [auth H]
histone H2B.2 -