3D View: 2M90

Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid

Citation:

See Citation Policies for referencing Mol*, RCSB PDB, PDB structures, and Computed Structure Models.

Select a different viewer

RCSB PDB is hosted by

RCSB PDB is a member of

RCSB Partners
Nucleic Acid Knowledgebase

CoreTrustSeal

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM157729. RCSB PDB uses resources of the National Energy Research Scientific Computing Center (NERSC), a Department of Energy User Facility.