5E3N
Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)
Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.
| Version Number | Version Date | Version Type/Reason | Version Change | Revised CIF Category | |
|---|---|---|---|---|---|
| 1.0 | 2016-03-09 | Initial release | |||
| 1.1 | 2016-03-23 | Database references | |||
| 1.2 | 2022-03-23 | Author supporting evidence, Data collection, Database references, Derived calculations | database_2, diffrn_radiation_wavelength, pdbx_audit_support, pdbx_struct_oper_list | ||
| 1.3 | 2024-05-22 | Data collection, Refinement description | chem_comp_atom, chem_comp_bond, struct_ncs_dom_lim | Download |
