5DS9

Crystal structure of Fis bound to 27bp DNA F1-8A (AAATTAGTTTGAATTTTGAGCTAATTT)


Changes made to a PDB entry after its initial release are considered to be either “major” or “minor”. The latest minor version of each major version is available as a file download. More information about the PDB versioning is available.


Version NumberVersion DateVersion Type/Reason Version ChangeRevised CIF Category
1.02016-07-27Initial release
1.12023-09-27Data collection, Database references, Derived calculations, Refinement descriptionchem_comp_atom, chem_comp_bond, database_2, diffrn_radiation_wavelength, pdbx_initial_refinement_model, pdbx_prerelease_seq, pdbx_struct_oper_list Download