2R1J
Crystal Structure of the P22 c2 Repressor protein in complex with the synthetic operator 9T
X-RAY DIFFRACTION
Crystallization
Crystalization Experiments | ||||
---|---|---|---|---|
ID | Method | pH | Temperature | Details |
1 | VAPOR DIFFUSION, HANGING DROP | 7.8 | 277 | The initial crystallization solution contained 0.42 mM P22R NTD, 0.42 mM duplex d(5 TATTTAAGATATCTTAAATG3 ) -d(5 CATTTAAGATATCTTAAATA3 ), 45 mM Tris.HCl (pH 7.8), 19 mM NaCl, 1.9 mM glycerol, 11% PEG 400, 4.5 mM LiCl, 2.3mM MgCl2 and 0.91% MPD in a volume of 5.3 ul. The crystallization solution was equilibrated against a reservoir of 100 mM Tris.HCl (pH 7.8), 25% PEG 400, 10 mM LiCl, 5 mM MgCl2 and 2% MPD, VAPOR DIFFUSION, HANGING DROP, temperature 277K |
Crystal Properties | |
---|---|
Matthews coefficient | Solvent content |
3.8 | 67.61 |
Crystal Data
Unit Cell | |
---|---|
Length ( Å ) | Angle ( ˚ ) |
a = 64.105 | α = 90 |
b = 64.105 | β = 90 |
c = 101.685 | γ = 90 |
Symmetry | |
---|---|
Space Group | P 43 |
Diffraction
Diffraction Experiment | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Crystal ID | Scattering Type | Data Collection Temperature | Detector | Detector Type | Details | Collection Date | Monochromator | Protocol | |||||
1 | 1 | x-ray | 100 | CCD | MARMOSAIC 300 mm CCD | M | SINGLE WAVELENGTH |
Radiation Source | |||||
---|---|---|---|---|---|
ID # | Source | Type | Wavelength List | Synchrotron Site | Beamline |
1 | SYNCHROTRON | APS BEAMLINE 22-ID | 1 | APS | 22-ID |
Data Collection
Overall | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Resolution (High) | Resolution (Low) | Percent Possible (Observed) | R Sym I (Observed) | Net I Over Average Sigma (I) | Redundancy | Number Reflections (All) | Number Reflections (Observed) | Observed Criterion Sigma (F) | Observed Criterion Sigma (I) | B (Isotropic) From Wilson Plot | ||||||||
1 | 1.53 | 35 | 99.4 | 0.069 | 47.1 | 5.8 | 60878 | 60878 |
Highest Resolution Shell | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Resolution (High) | Resolution (Low) | Percent Possible (All) | Percent Possible (Observed) | R Merge I (Observed) | R-Sym I (Observed) | Mean I Over Sigma (Observed) | Redundancy | Number Unique Reflections (All) | ||||||||||
1.53 | 1.57 | 99.3 | 0.659 | 0.659 | 2.12 | 4.7 | 4319 |
Refinement
Statistics | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction ID | Structure Solution Method | Resolution (High) | Resolution (Low) | Number Reflections (Observed) | Number Reflections (R-Free) | Percent Reflections (Observed) | R-Work | R-Free | Mean Isotropic B | ||||||||||
X-RAY DIFFRACTION | MOLECULAR REPLACEMENT | 1.53 | 35 | 59833 | 6068 | 96.9 | 0.204 | 0.225 | 31.053 |
Temperature Factor Modeling | ||||||
---|---|---|---|---|---|---|
Anisotropic B[1][1] | Anisotropic B[1][2] | Anisotropic B[1][3] | Anisotropic B[2][2] | Anisotropic B[2][3] | Anisotropic B[3][3] | |
RMS Deviations | |
---|---|
Key | Refinement Restraint Deviation |
c_scangle_it | 3.05 |
c_mcangle_it | 2.006 |
c_scbond_it | 1.983 |
c_angle_deg | 1.334 |
c_mcbond_it | 1.278 |
c_bond_d | 0.01 |
Non-Hydrogen Atoms Used in Refinement | |
---|---|
Non-Hydrogen Atoms | Number |
Protein Atoms | 1030 |
Nucleic Acid Atoms | 814 |
Solvent Atoms | 331 |
Heterogen Atoms |
Software
Software | |
---|---|
Software Name | Purpose |
DENZO | data reduction |
SCALEPACK | data scaling |
CNS | refinement |
PDB_EXTRACT | data extraction |
HKL-2000 | data collection |
CNS | phasing |