Experiment: 1K1S

X-RAY DIFFRACTION

Crystallization

Crystalization Experiments
ID	Method	pH	Temperature	Details
1	VAPOR DIFFUSION, HANGING DROP	6.2	298	Peg2000, sodium cacodylate, sodium fluoride, magnesium chloride, sucrose monolaurate, dATP, DNA hairpin (5' TTTTTTTTTTAGATGTCGATGCAATCGACATCT* 3' terminated by 3'deoxythymine ), pH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K

Crystal Properties
Matthews coefficient	Solvent content
2.88	57.32

Crystal Data

Unit Cell
Length ( Å )	Angle ( ˚ )
a = 113.04	α = 90
b = 113.04	β = 90
c = 62.58	γ = 120

Symmetry
Space Group	P 62

Diffraction

Diffraction Experiment
ID #	Crystal ID	Scattering Type	Data Collection Temperature	Detector	Detector Type	Details	Collection Date	Monochromator	Protocol
1	1	x-ray	100	CCD	BRANDEIS - B4	Wiggler	2001-07-26	M	SINGLE WAVELENGTH

Radiation Source
ID #	Source	Type	Wavelength List	Synchrotron Site	Beamline
1	SYNCHROTRON	NSLS BEAMLINE X25	1.1	NSLS	X25

Data Collection

Overall
ID #	Resolution (High)	Resolution (Low)	Percent Possible (Observed)	R Merge I (Observed)	Net I Over Average Sigma (I)	Redundancy	Number Reflections (All)	Number Reflections (Observed)	Observed Criterion Sigma (F)	Observed Criterion Sigma (I)	B (Isotropic) From Wilson Plot
1	2.8	37	99.9	0.08	20.1	7.1	11002	11002

Highest Resolution Shell
ID #	Resolution (High)	Resolution (Low)	Percent Possible (All)	Percent Possible (Observed)	R Merge I (Observed)	Mean I Over Sigma (Observed)	Redundancy	Number Unique Reflections (All)
	2.8	2.9	100		0.501	4.7	7.1	1126

Refinement

Statistics
Diffraction ID	Structure Solution Method	Cross Validation method	Starting model	Resolution (High)	Resolution (Low)	Number Reflections (All)	Number Reflections (Observed)	Number Reflections (R-Free)	Percent Reflections (Observed)	R-Work	R-Free	R-Free Selection Details	Mean Isotropic B
X-RAY DIFFRACTION	MOLECULAR REPLACEMENT	THROUGHOUT	PDB entry 1IM4	2.8	37	11002	11002	1159	96.6	0.237	0.279	RANDOM	72.9

Temperature Factor Modeling
Anisotropic B[1][1]	Anisotropic B[1][2]	Anisotropic B[1][3]	Anisotropic B[2][2]	Anisotropic B[2][3]	Anisotropic B[3][3]
9.28	19.43		10.26		-19.54

RMS Deviations
Key	Refinement Restraint Deviation
c_dihedral_angle_d	21.1
c_scangle_it	3.46
c_scbond_it	2.7
c_mcangle_it	2.14
c_mcbond_it	1.24
c_angle_deg	0.9
c_improper_angle_d	0.7
c_bond_d	0.004

Non-Hydrogen Atoms Used in Refinement
Non-Hydrogen Atoms	Number
Protein Atoms	2671
Nucleic Acid Atoms
Solvent Atoms	31
Heterogen Atoms

Software

Software
Software Name	Purpose
AMoRE	phasing
CNS	refinement
DENZO	data reduction
SCALEPACK	data scaling

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM133198.