
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid

  • Classification: DNA

  • Deposited: 2013-05-30 Released: 2013-07-10 
  • Deposition Author(s): Lim, K.W., Phan, A.T.

Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the lowest energy 

wwPDB Validation 3D Report Full Report

This is version 1.0 of the entry. See complete history


Structural Basis of DNA Quadruplex-Duplex Junction Formation

Lim, K.W.Phan, A.T.

(2013) Angew.Chem.Int.Ed.Engl. --: --


Find similar proteins by: Sequence  |  Structure

Entity ID: 1
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 10 
  • Selection Criteria: structures with the lowest energy 

Structure Validation

View Full Validation Report or Ramachandran Plots

Entry History 

Deposition Data

  • Deposited Date: 2013-05-30 
  • Released Date: 2013-07-10 
  • Deposition Author(s): Lim, K.W., Phan, A.T.

Revision History 

  • Version 1.0: 2013-07-10
    Type: Initial release