1TLR | pdb_00001tlr

SOLUTION STRUCTURE OF TETRALOOP RECEPTOR RNA, NMR, 20 STRUCTURES


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 20 
  • Selection Criteria: LOWEST ENERGY STRUCTURES 

wwPDB Validation   3D Report Full Report


This is version 1.4 of the entry. See complete history


Literature

Solution structure of a GAAA tetraloop receptor RNA.

Butcher, S.E.Dieckmann, T.Feigon, J.

(1997) EMBO J 16: 7490-7499

  • DOI: https://doi.org/10.1093/emboj/16.24.7490
  • Primary Citation of Related Structures:  
    1TLR

  • PubMed Abstract: 

    The GAAA tetraloop receptor is an 11-nucleotide RNA sequence that participates in the tertiary folding of a variety of large catalytic RNAs by providing a specific binding site for GAAA tetraloops. Here we report the solution structure of the isolated tetraloop receptor as solved by multidimensional, heteronuclear magnetic resonance spectroscopy. The internal loop of the tetraloop receptor has three adenosines stacked in a cross-strand or zipper-like fashion. This arrangement produces a high degree of base stacking within the asymmetric internal loop without extrahelical bases or kinking the helix. Additional interactions within the internal loop include a U. U mismatch pair and a G.U wobble pair. A comparison with the crystal structure of the receptor RNA bound to its tetraloop shows that a conformational change has to occur upon tetraloop binding, which is in good agreement with previous biochemical data. A model for an alternative binding site within the receptor is proposed based on the NMR structure, phylogenetic data and previous crystallographic structures of tetraloop interactions.


  • Organizational Affiliation
    • Department of Chemistry and Biochemistry, and Molecular Biology Institute, University of California, Los Angeles, CA 90095-1569, USA.

Macromolecules

Find similar nucleic acids by:  Sequence   |   3D Structure  

Entity ID: 1
MoleculeChains LengthOrganismImage
RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACUUCGGUUAUGGCC)-3')23N/A
Sequence Annotations
Expand
  • Reference Sequence
Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100 
  • Conformers Submitted: 20 
  • Selection Criteria: LOWEST ENERGY STRUCTURES 

Structure Validation

View Full Validation Report



Entry History 

Deposition Data

Revision History  (Full details and data files)

  • Version 1.0: 1997-11-12
    Type: Initial release
  • Version 1.1: 2008-03-24
    Changes: Version format compliance
  • Version 1.2: 2011-07-13
    Changes: Version format compliance
  • Version 1.3: 2022-03-02
    Changes: Database references, Derived calculations, Other
  • Version 1.4: 2024-05-22
    Changes: Data collection