5E3M
Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)
X-RAY DIFFRACTION
Crystallization
Crystalization Experiments | ||||
---|---|---|---|---|
ID | Method | pH | Temperature | Details |
1 | VAPOR DIFFUSION, HANGING DROP | 8.5 | 277 | 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400 |
Crystal Properties | |
---|---|
Matthews coefficient | Solvent content |
4.06 | 69.68 |
Crystal Data
Unit Cell | |
---|---|
Length ( Å ) | Angle ( ˚ ) |
a = 161.88 | α = 90 |
b = 43.22 | β = 111.52 |
c = 97.16 | γ = 90 |
Symmetry | |
---|---|
Space Group | C 1 2 1 |
Diffraction
Diffraction Experiment | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Crystal ID | Scattering Type | Data Collection Temperature | Detector | Detector Type | Details | Collection Date | Monochromator | Protocol | |||||
1 | 1 | x-ray | 100 | CCD | ADSC QUANTUM 315 | 2007-03-05 | M | SINGLE WAVELENGTH |
Radiation Source | |||||
---|---|---|---|---|---|
ID # | Source | Type | Wavelength List | Synchrotron Site | Beamline |
1 | SYNCHROTRON | ALS BEAMLINE 8.2.2 | 1.000 | ALS | 8.2.2 |
Data Collection
Overall | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Resolution (High) | Resolution (Low) | Percent Possible (Observed) | R Merge I (Observed) | Rpim I (All) | CC (Half) | Net I Over Average Sigma (I) | Redundancy | Number Reflections (All) | Number Reflections (Observed) | Observed Criterion Sigma (F) | Observed Criterion Sigma (I) | B (Isotropic) From Wilson Plot | ||||||
1 | 2.88 | 40.412 | 94.4 | 0.082 | 0.034 | 0.998 | 13.7 | 6.6 | 13581 | 35.76 |
Highest Resolution Shell | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ID # | Resolution (High) | Resolution (Low) | Percent Possible (All) | Percent Possible (Observed) | R Merge I (Observed) | Rpim I (All) | CC (Half) | Mean I Over Sigma (Observed) | Redundancy | Number Unique Reflections (All) | |||||||||
1 | 2.88 | 3.04 | 99 | 0.916 | 0.37 | 0.801 | 2.4 | 7.1 | 2023 |
Refinement
Statistics | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Diffraction ID | Structure Solution Method | Cross Validation method | Resolution (High) | Resolution (Low) | Cut-off Sigma (F) | Number Reflections (Observed) | Number Reflections (R-Free) | Percent Reflections (Observed) | R-Factor (Observed) | R-Work | R-Free | Mean Isotropic B | |||||||
X-RAY DIFFRACTION | MOLECULAR REPLACEMENT | FREE R-VALUE | 2.886 | 40.412 | 1.34 | 13305 | 659 | 92.17 | 0.1818 | 0.1795 | 0.2259 | 43.4773 |
Temperature Factor Modeling | ||||||
---|---|---|---|---|---|---|
Anisotropic B[1][1] | Anisotropic B[1][2] | Anisotropic B[1][3] | Anisotropic B[2][2] | Anisotropic B[2][3] | Anisotropic B[3][3] | |
RMS Deviations | |
---|---|
Key | Refinement Restraint Deviation |
f_dihedral_angle_d | 25.764 |
f_angle_d | 1.776 |
f_chiral_restr | 0.091 |
f_bond_d | 0.02 |
f_plane_restr | 0.012 |
Non-Hydrogen Atoms Used in Refinement | |
---|---|
Non-Hydrogen Atoms | Number |
Protein Atoms | 1502 |
Nucleic Acid Atoms | 1101 |
Solvent Atoms | 7 |
Heterogen Atoms |
Software
Software | |
---|---|
Software Name | Purpose |
PHENIX | refinement |
Aimless | data scaling |
PHASER | phasing |
PDB_EXTRACT | data extraction |
XDS | data reduction |