Annotations: 4ZCF

Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I

External Resource: Annotation

Domain Annotation: ECOD Classification
Domain Annotation: CATH
Gene Ontology: Gene Product Annotation
InterPro: Protein Family Classification

Domain Annotation: ECOD Classification ECOD Database Homepage

Chains	Family Name	Domain Identifier	Architecture	Possible Homology	Homology	Topology	Family	Provenance Source (Version)
C		e4zcfC1	A: alpha arrays	X: Bromodomain-like	H: SidC N-terminal domain	T: SidC N-terminal domain	F:	ECOD (v295.2)
B	N6_N4_Mtase	e4zcfB1	A: alpha arrays	X: Rossmann-like	H: Rossmann-related	T: S-adenosyl-L-methionine-dependent methyltransferases	F: N6_N4_Mtase	ECOD (v295.2)
B		e4zcfB2	A: alpha arrays	X: Type III R-M system modification subunit target recognition domain	H: Type III R-M system modification subunit target recognition domain	T: Type III R-M system modification subunit target recognition domain	F:	ECOD (v295.2)
B		e4zcfB3	A: alpha arrays	X: Bromodomain-like	H: SidC N-terminal domain	T: SidC N-terminal domain	F:	ECOD (v295.2)
A	Molybdopterin	e4zcfA1	A: alpha arrays	X: jelly-roll	H: Double-stranded beta-helix	T: Double-stranded beta-helix	F: Molybdopterin	ECOD (v295.2)

Domain Annotation: CATH CATH Database Homepage

Chain	Domain	Class	Architecture	Topology	Homology	Provenance Source (Version)
C	3.40.50.300	Alpha Beta	3-Layer(aba) Sandwich	Rossmann fold	P-loop containing nucleotide triphosphate hydrolases	CATH (utative)

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

Chains	Polymer	Molecular Function	Biological Process	Cellular Component
E	DNA 20-mer AATCATAGTCTACTGCTGTA	-	-	-
D	DNA 20-mer ATACAGCAGTAGACTATGAT	-	-	-
C	Restriction endonuclease EcoP15I, restriction subunit	binding adenyl ribonucleotide binding nucleotide binding purine ribonucleotide binding purine ribonucleoside triphosphate binding nucleoside phosphate binding ion binding purine nucleotide binding anion binding adenyl nucleotide binding ATP binding heterocyclic compound binding carbohydrate derivative binding ribonucleotide binding binding adenyl ribonucleotide binding nucleotide binding purine ribonucleotide binding purine ribonucleoside triphosphate binding nucleoside phosphate binding ion binding purine nucleotide binding anion binding adenyl nucleotide binding ATP binding heterocyclic compound binding carbohydrate derivative binding ribonucleotide binding small molecule binding DNA binding nucleic acid binding endonuclease activity catalytic activity, acting on a nucleic acid hydrolase activity DNA nuclease activity type III site-specific deoxyribonuclease activity restriction endodeoxyribonuclease activity DNA endonuclease activity hydrolase activity, acting on ester bonds catalytic activity, acting on DNA nuclease activity DNA endonuclease activity, producing 5'-phosphomonoesters catalytic activity nucleic acid conformation isomerase activity isomerase activity helicase activity macromolecular conformation isomerase activity ATP-dependent activity	biological process involved in interspecies interaction between organisms response to stimulus response to other organism defense response DNA restriction-modification system defense response to symbiont response to external stimulus primary metabolic process clearance of foreign intracellular DNA clearance of foreign intracellular nucleic acids DNA metabolic process response to biotic stimulus nucleic acid metabolic process nucleobase-containing compound metabolic process DNA modification biological process involved in interspecies interaction between organisms response to stimulus response to other organism defense response DNA restriction-modification system defense response to symbiont response to external stimulus primary metabolic process clearance of foreign intracellular DNA clearance of foreign intracellular nucleic acids DNA metabolic process response to biotic stimulus nucleic acid metabolic process nucleobase-containing compound metabolic process DNA modification defense response to other organism response to stress macromolecule modification metabolic process cellular process response to external biotic stimulus macromolecule metabolic process	-
A, B	Restriction endonuclease EcoP15I, modification subunit	DNA binding binding nucleic acid binding transferase activity, transferring one-carbon groups N-methyltransferase activity transferase activity methyltransferase activity catalytic activity DNA-methyltransferase activity catalytic activity, acting on DNA site-specific DNA-methyltransferase (adenine-specific) activity catalytic activity, acting on a nucleic acid S-adenosylmethionine-dependent methyltransferase activity	methylation metabolic process cellular process biological process involved in interspecies interaction between organisms response to stimulus response to other organism defense response DNA restriction-modification system defense response to symbiont response to external stimulus primary metabolic process clearance of foreign intracellular DNA clearance of foreign intracellular nucleic acids DNA metabolic process methylation metabolic process cellular process biological process involved in interspecies interaction between organisms response to stimulus response to other organism defense response DNA restriction-modification system defense response to symbiont response to external stimulus primary metabolic process clearance of foreign intracellular DNA clearance of foreign intracellular nucleic acids DNA metabolic process response to biotic stimulus nucleic acid metabolic process nucleobase-containing compound metabolic process DNA modification defense response to other organism response to stress macromolecule modification response to external biotic stimulus macromolecule metabolic process	-

InterPro: Protein Family Classification InterPro Database Homepage

Chains	Accession	Name	Type
C	IPR006935	Helicase/UvrB, N-terminal	Domain
C	IPR045572	Type III restriction enzyme, C-terminal endonuclease domain	Domain
C	IPR027417	P-loop containing nucleoside triphosphate hydrolase	Homologous Superfamily
A, B	IPR041405	Type III R-M EcoP15I, C-terminal	Domain
A, B	IPR002052	DNA methylase, N-6 adenine-specific, conserved site	Conserved Site
A, B	IPR002941	DNA methylase N-4/N-6	Domain
A, B	IPR029063	S-adenosyl-L-methionine-dependent methyltransferase superfamily	Homologous Superfamily
A, B	IPR002295	N4/N6-methyltransferase, Type III restriction-modification enzyme EcoPI Mod subunit-like	Family

RCSB PDB is hosted by

RCSB PDB is a member of

RCSB Partners
Nucleic Acid Knowledgebase

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM157729. RCSB PDB uses resources of the National Energy Research Scientific Computing Center (NERSC), a Department of Energy User Facility.

4ZCF | pdb_00004zcf

Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I

External Resource: Annotation

Domain Annotation: ECOD Classification ECOD Database Homepage

Domain Annotation: CATH CATH Database Homepage

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

InterPro: Protein Family Classification InterPro Database Homepage