Annotations: 4P0R

Domain Annotation: ECOD Classification ECOD Database Homepage

Chains	Family Name	Domain Identifier	Architecture	Possible Homology	Homology	Topology	Family	Provenance Source (Version)
C	PF21292	e4p0rC1	A: alpha arrays	X: HhH/H2TH	H: SAM/DNA-glycosylase	T: SAM domain-like	F: PF21292	ECOD (1.6)
C	PF02732	e4p0rC2	A: a/b three-layered sandwiches	X: Restriction endonuclease-like	H: Restriction endonuclease-like (From Topology)	T: Restriction endonuclease-like	F: PF02732	ECOD (1.6)
A	PF21292	e4p0rA1	A: alpha arrays	X: HhH/H2TH	H: SAM/DNA-glycosylase	T: SAM domain-like	F: PF21292	ECOD (1.6)
A	PF02732	e4p0rA2	A: a/b three-layered sandwiches	X: Restriction endonuclease-like	H: Restriction endonuclease-like (From Topology)	T: Restriction endonuclease-like	F: PF02732	ECOD (1.6)
B	PF21292	e4p0rB1	A: alpha arrays	X: HhH/H2TH	H: SAM/DNA-glycosylase	T: SAM domain-like	F: PF21292	ECOD (1.6)
B	F_UNCLASSIFIED	e4p0rB2	A: a/b three-layered sandwiches	X: Restriction endonuclease-like	H: Restriction endonuclease-like (From Topology)	T: Restriction endonuclease-like	F: F_UNCLASSIFIED	ECOD (1.6)
D	PF21292	e4p0rD1	A: alpha arrays	X: HhH/H2TH	H: SAM/DNA-glycosylase	T: SAM domain-like	F: PF21292	ECOD (1.6)
D	F_UNCLASSIFIED	e4p0rD2	A: a/b three-layered sandwiches	X: Restriction endonuclease-like	H: Restriction endonuclease-like (From Topology)	T: Restriction endonuclease-like	F: F_UNCLASSIFIED	ECOD (1.6)

Protein Family Annotation Pfam Database Homepage

Chains	Accession	Name	Description	Comments	Source
A, C	PF21292	EME1/MUS81, C-terminal (EME1-MUS81_C)	EME1/MUS81, C-terminal	EME1 and MUS81 form a complex that acts as a structure-specific endonuclease, playing an important role in rescuing stalled replication forks and resolving the meiotic recombination intermediates in eukaryotes [1,2]. Both consist of a central nuclea ...	EME1 and MUS81 form a complex that acts as a structure-specific endonuclease, playing an important role in rescuing stalled replication forks and resolving the meiotic recombination intermediates in eukaryotes [1,2]. Both consist of a central nuclease domain (Pfam:PF02732), two repeats of the helix-hairpin-helix (HhH) motif and a linker helix. This entry represents the C-terminal HhH domain of EME1 and MUS81 [1,2]. Similar to EME1-MUS81, human MUS81-EME2 cleaves 3'-flaps, replication forks and nicked Holliday junctions, and exhibits limited endonuclease activity with intact Holliday junctions.	Domain
A, C	PF02732	ERCC4 domain (ERCC4)	ERCC4 domain	This domain is a family of nucleases. The family includes EME1 which is an essential component of a Holliday junction resolvase [2-3]. EME1 interacts with MUS81 to form a DNA structure-specific endonuclease.	Domain
B, D	PF21292	EME1/MUS81, C-terminal (EME1-MUS81_C)	EME1/MUS81, C-terminal	EME1 and MUS81 form a complex that acts as a structure-specific endonuclease, playing an important role in rescuing stalled replication forks and resolving the meiotic recombination intermediates in eukaryotes [1,2]. Both consist of a central nuclea ...	EME1 and MUS81 form a complex that acts as a structure-specific endonuclease, playing an important role in rescuing stalled replication forks and resolving the meiotic recombination intermediates in eukaryotes [1,2]. Both consist of a central nuclease domain (Pfam:PF02732), two repeats of the helix-hairpin-helix (HhH) motif and a linker helix. This entry represents the C-terminal HhH domain of EME1 and MUS81 [1,2]. Similar to EME1-MUS81, human MUS81-EME2 cleaves 3'-flaps, replication forks and nicked Holliday junctions, and exhibits limited endonuclease activity with intact Holliday junctions.	Domain
B, D	PF02732	ERCC4 domain (ERCC4)	ERCC4 domain	This domain is a family of nucleases. The family includes EME1 which is an essential component of a Holliday junction resolvase [2-3]. EME1 interacts with MUS81 to form a DNA structure-specific endonuclease.	Domain

Gene Ontology: Gene Product Annotation Gene Ontology Database Homepage

Chains	Polymer	Molecular Function	Biological Process	Cellular Component
A, C	Crossover junction endonuclease MUS81	endonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 3'-phosphomonoesters endonuclease activity catalytic activity, acting on a nucleic acid hydrolase activity 3'-flap endonuclease activity DNA nuclease activity DNA endonuclease activity DNA endonuclease activity, producing 3'-phosphomonoesters catalytic activity, acting on DNA nuclease activity hydrolase activity, acting on ester bonds flap endonuclease activity catalytic activity DNA binding endonuclease activity, active with either ribo- or deoxyribonucleic acids and producing 3'-phosphomonoesters endonuclease activity catalytic activity, acting on a nucleic acid hydrolase activity 3'-flap endonuclease activity DNA nuclease activity DNA endonuclease activity DNA endonuclease activity, producing 3'-phosphomonoesters catalytic activity, acting on DNA nuclease activity hydrolase activity, acting on ester bonds flap endonuclease activity catalytic activity DNA binding binding organic cyclic compound binding nucleic acid binding crossover junction DNA endonuclease activity cation binding ion binding metal ion binding small molecule binding	catabolic process primary metabolic process DNA metabolic process macromolecule catabolic process organic cyclic compound catabolic process nucleic acid metabolic process nucleobase-containing compound catabolic process nucleobase-containing compound metabolic process organic cyclic compound metabolic process organic substance metabolic process DNA catabolic process nucleic acid catabolic process metabolic process macromolecule metabolic process catabolic process primary metabolic process DNA metabolic process macromolecule catabolic process organic cyclic compound catabolic process nucleic acid metabolic process nucleobase-containing compound catabolic process nucleobase-containing compound metabolic process organic cyclic compound metabolic process organic substance metabolic process DNA catabolic process nucleic acid catabolic process metabolic process macromolecule metabolic process organic substance catabolic process DNA-templated DNA replication DNA-templated DNA replication maintenance of fidelity DNA replication replication fork processing cell population proliferation cellular process osteoblast proliferation sexual reproduction homologous recombination reproductive process resolution of meiotic recombination intermediates meiotic cell cycle process cellular component organization meiosis I meiotic nuclear division cell cycle cellular component organization or biogenesis reciprocal homologous recombination cell cycle process meiotic cell cycle DNA recombination organelle fission reciprocal meiotic recombination nuclear division organelle organization meiosis I cell cycle process cellular response to stimulus double-strand break repair response to stimulus double-strand break repair via break-induced replication cellular response to stress DNA damage response response to stress recombinational repair double-strand break repair via homologous recombination DNA repair DNA damage checkpoint signaling regulation of cellular process regulation of cell cycle phase transition signaling negative regulation of biological process negative regulation of cell cycle cell cycle phase transition intracellular signal transduction mitotic cell cycle negative regulation of mitotic cell cycle cell communication regulation of mitotic cell cycle mitotic DNA integrity checkpoint signaling mitotic DNA damage checkpoint signaling negative regulation of cellular process negative regulation of cell cycle phase transition signal transduction mitotic intra-S DNA damage checkpoint signaling regulation of cell cycle regulation of biological process regulation of cell cycle process biological regulation DNA integrity checkpoint signaling negative regulation of cell cycle process cell cycle checkpoint signaling mitotic cell cycle checkpoint signaling mitotic cell cycle process signal transduction in response to DNA damage response to endogenous stimulus response to intra-S DNA damage checkpoint signaling response to biotic stimulus cellular response to biotic stimulus cellular response to endogenous stimulus response to DNA integrity checkpoint signaling response to DNA damage checkpoint signaling response to cell cycle checkpoint signaling	membrane-bounded organelle intracellular anatomical structure nucleus membrane-enclosed lumen intracellular membrane-bounded organelle cellular anatomical entity nucleolus intracellular organelle lumen intracellular organelle organelle lumen organelle intracellular non-membrane-bounded organelle nuclear lumen non-membrane-bounded organelle membrane-bounded organelle intracellular anatomical structure nucleus membrane-enclosed lumen intracellular membrane-bounded organelle cellular anatomical entity nucleolus intracellular organelle lumen intracellular organelle organelle lumen organelle intracellular non-membrane-bounded organelle nuclear lumen non-membrane-bounded organelle protein-containing complex catalytic complex endodeoxyribonuclease complex Holliday junction resolvase complex intracellular protein-containing complex endonuclease complex nucleoplasm replication fork chromosome nuclear replication fork nuclear chromosome
B, D	Crossover junction endonuclease EME1	DNA binding binding organic cyclic compound binding nucleic acid binding endonuclease activity nuclease activity hydrolase activity, acting on ester bonds hydrolase activity catalytic activity cation binding ion binding metal ion binding small molecule binding	DNA-templated DNA replication DNA-templated DNA replication maintenance of fidelity primary metabolic process DNA metabolic process nucleic acid metabolic process nucleobase-containing compound metabolic process organic cyclic compound metabolic process DNA replication organic substance metabolic process metabolic process macromolecule metabolic process replication fork processing sexual reproduction homologous recombination DNA-templated DNA replication DNA-templated DNA replication maintenance of fidelity primary metabolic process DNA metabolic process nucleic acid metabolic process nucleobase-containing compound metabolic process organic cyclic compound metabolic process DNA replication organic substance metabolic process metabolic process macromolecule metabolic process replication fork processing sexual reproduction homologous recombination reproductive process resolution of meiotic recombination intermediates meiotic cell cycle process cellular component organization meiosis I meiotic nuclear division cell cycle cellular component organization or biogenesis reciprocal homologous recombination cell cycle process meiotic cell cycle DNA recombination organelle fission reciprocal meiotic recombination nuclear division organelle organization meiosis I cell cycle process cellular process cellular response to stimulus double-strand break repair response to stimulus cellular response to stress DNA damage response response to stress DNA repair DNA damage checkpoint signaling regulation of cellular process regulation of cell cycle phase transition signaling negative regulation of biological process negative regulation of cell cycle cell cycle phase transition intracellular signal transduction mitotic cell cycle negative regulation of mitotic cell cycle cell communication regulation of mitotic cell cycle mitotic DNA integrity checkpoint signaling mitotic DNA damage checkpoint signaling negative regulation of cellular process negative regulation of cell cycle phase transition signal transduction mitotic intra-S DNA damage checkpoint signaling regulation of cell cycle regulation of biological process regulation of cell cycle process biological regulation DNA integrity checkpoint signaling negative regulation of cell cycle process cell cycle checkpoint signaling mitotic cell cycle checkpoint signaling mitotic cell cycle process signal transduction in response to DNA damage response to endogenous stimulus response to intra-S DNA damage checkpoint signaling response to biotic stimulus cellular response to biotic stimulus cellular response to endogenous stimulus response to DNA integrity checkpoint signaling response to DNA damage checkpoint signaling response to cell cycle checkpoint signaling	membrane-bounded organelle intracellular anatomical structure nucleus membrane-enclosed lumen intracellular membrane-bounded organelle cellular anatomical entity nucleolus intracellular organelle lumen intracellular organelle organelle lumen organelle intracellular non-membrane-bounded organelle nuclear lumen non-membrane-bounded organelle membrane-bounded organelle intracellular anatomical structure nucleus membrane-enclosed lumen intracellular membrane-bounded organelle cellular anatomical entity nucleolus intracellular organelle lumen intracellular organelle organelle lumen organelle intracellular non-membrane-bounded organelle nuclear lumen non-membrane-bounded organelle protein-containing complex protein-DNA complex chromatin chromosome heterochromatin catalytic complex endodeoxyribonuclease complex Holliday junction resolvase complex intracellular protein-containing complex endonuclease complex nuclear replication fork nuclear chromosome replication fork nucleoplasm
E, H	DNA CTGTGTGTAAGCACG	-	-	-
F, I	DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT	-	-	-
G, J	DNA CAAGTTCACCCTAACCTCAG	-	-	-

InterPro: Protein Family Classification InterPro Database Homepage

Chains	Accession	Name	Type
A, C	IPR011335	Restriction endonuclease type II-like	Homologous Superfamily
A, C	IPR047417	MUS81, winged helix domain	Domain
A, C	IPR027421	DNA polymerase lambda lyase domain superfamily	Homologous Superfamily
A, C	IPR006166	ERCC4 domain	Domain
A, C	IPR047416	MUS81, XPF-like nuclease domain	Domain
A, C	IPR042530	EME1/EME2, C-terminal domain	Homologous Superfamily
A, C	IPR033309	Crossover junction endonuclease Mus81	Family
A, C	IPR036388	Winged helix-like DNA-binding domain superfamily	Homologous Superfamily
B, D	IPR043087	EME1, nuclease domain, subdomain 2	Homologous Superfamily
B, D	IPR042530	EME1/EME2, C-terminal domain	Homologous Superfamily
B, D	IPR047522	Crossover junction endonuclease EME1, XPF-like nuclease domain, vertebrates	Domain
B, D	IPR033310	Mms4/EME1/EME2	Family
B, D	IPR043086	EME1, nuclease domain, subdomain 1	Homologous Superfamily
B, D	IPR006166	ERCC4 domain	Domain

Pharos: Disease Associations Pharos Homepage Annotation

Chains	Drug Target	Associated Disease
A, C	Pharos: Q96NY9	allergic rhinitis Crohn disease ovarian cancer systemic lupus erythematosus atopic eczema inflammatory bowel disease psoriasis breast carcinoma osteosarcoma skin basal cell carcinoma
B, D	Pharos: Q96AY2	astrocytic tumor chronic obstructive pulmonary disease exocrine pancreatic carcinoma invasive ductal breast carcinoma malignant pancreatic neoplasm ovarian cancer atypical teratoid rhabdoid tumor Crohn disease glioblastoma large cell medulloblastoma medulloblastoma breast cancer ductal breast carcinoma in situ interstitial cystitis lung adenocarcinoma astrocytic tumor chronic obstructive pulmonary disease exocrine pancreatic carcinoma invasive ductal breast carcinoma malignant pancreatic neoplasm ovarian cancer atypical teratoid rhabdoid tumor Crohn disease glioblastoma large cell medulloblastoma medulloblastoma breast cancer ductal breast carcinoma in situ interstitial cystitis lung adenocarcinoma osteosarcoma

RCSB PDB Core Operations are funded by the U.S. National Science Foundation (DBI-2321666), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM133198.