1QWA

NMR structure of 5\'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5\'ETS that binds nucleolin RBD12.

Explore Sequence Annotations in 3D

RCSB PDB Core Operations are funded by the National Science Foundation (DBI-1832184), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM133198.