Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid
DOI:10.2210/pdb2m93/pdb   NDB ID: 2M93
Primary Citation
  •   Molecular Description Hide
    Classification: DNA
    Structure Weight: 10066.50
    Molecule: 32-MER DNA
    Polymer: 1 Type: dna Length: 32
    Chains: A

  •   Related Citations in PDB Entry (REMARK 1) Hide
  •   Source Hide
    Polymer: 1
    Scientific Name: Synthetic construct   Taxonomy    
  •   Related PDB Entries Hide
    Identifier Details
  •   Structural Biology Knowledgebase Data Hide
  • Nucleic Acid Database Hide
    View the NDB ID associated with this structure:2M93
Data in orange boxes are gathered from external resources (when available).
Structure Image
Downloadable viewers: