NMR Ensemble

1TOB

SACCHARIDE-RNA RECOGNITION IN AN AMINOGLYCOSIDE ANTIBIOTIC-RNA APTAMER COMPLEX, NMR, 7 STRUCTURES

Structural Biology Knowledgebase: 1TOB SBKB.org


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 50
  • Conformers Submitted: 7
  • Selection Criteria: Energy (including Restraint Energy Term)

wwPDB Validation Full Report


Literature

Macromolecules
Sequence Display for 1TOB

Classification: RNA

Total Structure Weight: 9133.81

Macromolecule Entities
Molecule Chains Length Organism Details
RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3') A 27 synthetic

Small Molecules
Ligands 3 Unique
ID Chains Name / Formula / InChI Key 2D Diagram 3D Interactions
TOA
Query on TOA

A 3-DEOXY-3-AMINO GLUCOSE
C6 H14 N O5
BQCCAEOLPYCBAE-RXRWUWDJSA-O
Ligand Explorer
 
JSmol
TOB
Query on TOB

A 1,3-DIAMINO-5,6-DIHYDROXYCYCLOHEXANE
C6 H16 N2 O2
QOLDZWBHLDQIJR-FSIIMWSLSA-P
Ligand Explorer
 
JSmol
TOC
Query on TOC

A 2,3,6-TRIDEOXY-2,6-DIAMINO GLUCOSE
C6 H16 N2 O3
CEGXIUROHCNLCL-MOJAZDJTSA-P
Ligand Explorer
 
JSmol

Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 50
  • Conformers Submitted: 7
  • Selection Criteria: ENERGY (INCLUDING RESTRAINT ENERGY TERM)

Structure Validation

View Full Validation Report



Entry History

Deposition Data

  • Deposited Date: 1996-12-12
  • Released Date: 1997-06-16
  • Deposition author(s): Jiang, L., Suri, A.K., Fiala, R., Patel, D.J.

Revision History

  • 2011-07-13
    Type: Version format compliance | Details: compliance with PDB Exchange Dictionary V4