1TLR

SOLUTION STRUCTURE OF TETRALOOP RECEPTOR RNA, NMR, 20 STRUCTURES

Structural Biology Knowledgebase: 1TLR SBKB.org


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 20
  • Selection Criteria: Lowest Energy Structures

Literature

Macromolecules
Sequence Display for 1TLR

Classification: RNA

Total Structure Weight: 7356.44

Macromolecule Entities
Molecule Chains Length Organism Details
RNA TETRALOOP RECEPTOR (5'-R(GGCCUAAGACUUCGGUUAUGGCC)-3') A 23 synthetic


Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 20
  • Selection Criteria: LOWEST ENERGY STRUCTURES

Structure Validation

View Full Validation Report



Entry History

Deposition Data

  • Deposited Date: 1997-09-11
  • Released Date: 1997-11-12
  • Deposition author(s): Butcher, S.E., Dieckmann, T., Feigon, J.

Revision History

  • 2011-07-13
    Type: Version format compliance | Details: compliance with PDB Exchange Dictionary V4