1R7W

NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 50
  • Conformers Submitted: 20
  • Selection Criteria: Lowest Total Energy (a Weighted Sum of Conformational Energy and Restraint Energy)

Literature

Macromolecules
Sequence Display for 1R7W

Classification: RNA

Total Structure Weight: 10897.51

Macromolecule Entities
Molecule Chains Length Organism Details
34-MER A 34 synthetic RNA FRAGMENT OF ENTEROVIRAL IRES


Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 50
  • Conformers Submitted: 20
  • Selection Criteria: LOWEST TOTAL ENERGY (A WEIGHTED SUM OF CONFORMATIONAL ENERGY AND RESTRAINT ENERGY)

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History

Deposition Data

  • Deposited Date: 2003-10-22
  • Released Date: 2004-05-25
  • Deposition author(s): Du, Z., Ulyanov, N.B., Yu, J., James, T.L.

Revision History

  • Version 1_0: 2004-05-25

    Type: Initial release

  • Version 1_1: 2008-04-29

    Type: Version format compliance

  • Version 1_2: 2011-07-13

    Type: Version format compliance